Gene detail

Detail information of GWHGAAZE030838

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009354690.1	3.1563E-64	PREDICTED: 60S ribosomal protein L6-1-like [Pyrus x bretschneideri]
Swissprot	tr\|P34091\|RL6_MESCR	7E-53	60S ribosomal protein L6
trEMBL	tr\|G7J9R6\|G7J9R6_MEDTR	8E-59	60S ribosomal L6-like protein {ECO:0000313\|EMBL:AES72708.1}
TAIR10	AT1G74050.1	9E-35	Ribosomal protein L6 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	49168614	49169298	-
GWHAAZE00000009	mRNA	49168614	49169298	-
GWHAAZE00000009	exon	49169238	49169298	-
GWHAAZE00000009	exon	49169002	49169151	-
GWHAAZE00000009	exon	49168614	49168867	-
GWHAAZE00000009	CDS	49169238	49169298	-
GWHAAZE00000009	CDS	49169002	49169151	-
GWHAAZE00000009	CDS	49168614	49168867	-

Transcript Sequence
>GWHTAAZE030872 ATGGCACCAAAACAGAAAACCCCAAAGGTGACAAGAAACCCAGATATCGTAAGAGGAGTGGTACACGACATGAAGCCGGCTAATGCCGCTCCGGCAGAAAAGCCGACCAAGTTTTATCCAGTCAAGAAGCCACTTGTTAATAGGCGTAAACCTAAACCGACTAAGCTCAGGGCTAGTATTACTCCTGGAACAGTGCTGATAATATTGGCTGGGTTAAATGTGGACAAGTTTGATGACAAATACTTTGCAAAACAACTCGAGAAAAAGATGAAGAAAGGAGAAGGCGAGTTCTTTGAGGCAGAGAAAGAGGAGAAGAATGTCCTACCAACGGAGAAGAAAGATGACCAGAAAACCATTAATGCATGTTTGTTAAAATCCATTGAGGCAGTGCCAGACCTCAAAACCTATTTAGCTGCAAGGTTTTTGCTCAAGGCAGGCATGAAACCTCATGAGCTTGTCTTTTAG

Network for GWHGAAZE030838

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01159.20	Ribosomal_L6e	74	154	2.50E-20

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02934	RP-L6e, RPL6	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.240
	SRR3591706	second leaf	0.300
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.593
	SRR3591709	Stem	0.265
	SRR3591710	White floral bud	0.544
	SRR3591711	White flower	0.299
	SRR3591712	Green floral bud	0.407
	SRR3591713	Yellow flower	0.258
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.159
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.192
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.089
	SRR8316906	Gold flowering stage	0.083
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.137
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.148
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.022
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.099
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.142
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.072
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.225
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000