Gene detail

Detail information of GWHGAAZE030885

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006341406.1	8.4828E-129	PREDICTED: checkpoint protein HUS1-like [Solanum tuberosum]
trEMBL	tr\|M1B419\|M1B419_SOLTU	3E-129	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400036682}
TAIR10	AT1G52530.1	1E-91	Without detailed annotation

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	49831553	49833557	+
GWHAAZE00000009	mRNA	49831553	49833557	+
GWHAAZE00000009	exon	49831553	49831625	+
GWHAAZE00000009	exon	49832856	49833557	+
GWHAAZE00000009	five_prime_UTR	49831553	49831625	+
GWHAAZE00000009	five_prime_UTR	49832856	49832915	+
GWHAAZE00000009	CDS	49832916	49833557	+

Transcript Sequence
>GWHTAAZE030919 ACCTGAACTCTCCGCCTCTACCCTGCGCGGCGACTCTATTGGGAGGGTGACGGAGATTGCTTCTGAATTCCGTAGGAAAGAGAGAGACCCAAGGATCATTATTTGTCCCACCAATCCACCTAGAAGGTGAAAGATGAAGTTCAAAGCATTTCTCACAGACAATGGTGTAAACCTTTTAGAGAAGAGGTTCCTACCAGCCCTAGACAAAATGGGAAAAATCTGTCACCTGTATCTAACACGAGACCATGCAATTTTCCTCCACAACCTCCTAAATGGTGATGGCATCCAATCCATCGCCCAATTCCGAAAAGAGGCCCTATTTGATGATTACCGCATCTCCAGTCAGAATGATGACCGCATTGCCTTTGCCATTGACCTCTCCCTCCTTCACCGGGCCCTCCGGAGTATCATCACAATCTACACAGAATTCAGTGGTAACCCAAGTACTGGTGCTGGTGGGTCCACCTCCAACCGACTCCAAATCAAGCTGGTAAAAAAGCTCCCCCCTCATTCACAGCAACCAATGCCATTCCTCACTTTTGAGACCAAGGGTTACAAATCAGCTGTCATTCAAGATGTGCCCATCTCTAAACCTTTATCAAGAGCTGATGTACTTGAACTTCAAGCTGCACTTGATATGGCCCAAGATATGCCTCGGACTCTAGTTCAAGTCCCCGATATGAATCAGTTACAGAACTTCGTTGATCGAATGAAGCATGTAGGAGATTTGATCGATGTTTCTATAAGCAAATATGGGGACCTGCATTTGCAGATT

Network for GWHGAAZE030885

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04005.13	Hus1	1	214	2.20E-54

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K10903	HUS1	Cellular senescence	map04218

Gene Ontology

GO term	Ontology	Name
GO:0000077	biological_process	DNA damage checkpoint
GO:0005730	cellular_component	nucleolus
GO:0030896	cellular_component	checkpoint clamp complex

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.648
	SRR3591706	second leaf	1.392
	SRR3591707	mature leaf	1.297
	SRR3591708	Shoot apex	4.074
	SRR3591709	Stem	2.671
	SRR3591710	White floral bud	2.686
	SRR3591711	White flower	2.753
	SRR3591712	Green floral bud	3.248
	SRR3591713	Yellow flower	2.722
SRP173429	SRR8316895	Juvenile bud stage	2.930
	SRR8316896	Juvenile bud stage	3.137
	SRR8316897	Juvenile bud stage	0.683
	SRR8316894	Third green stage	1.596
	SRR8316900	Third green stage	3.330
	SRR8316901	Third green stage	2.885
	SRR8316898	Complete white stage	0.660
	SRR8316899	Complete white stage	3.297
	SRR8316903	Complete white stage	0.679
	SRR8316902	Silver flowering stage	0.561
	SRR8316904	Silver flowering stage	1.341
	SRR8316905	Silver flowering stage	1.117
	SRR8316906	Gold flowering stage	2.933
	SRR8316907	Gold flowering stage	1.946
	SRR8316908	Gold flowering stage	2.458
SRP132670	SRR6706286	Control	3.300
	SRR6706287	Light intensity 50%	4.765
	SRR6706288	Light intensity 20%	4.547
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.524
	CNS0095593	Slightly white alabastrum(diploid) 2	0.619
	CNS0095594	Slightly white alabastrum(diploid) 3	1.365
	CNS0095595	Whole white alabastrum(diploid) 2	2.782
	CNS0095596	Whole white alabastrum(diploid) 3	1.383
	CNS0095597	Whole white alabastrum(diploid) 4	1.183
	CNS0095598	Silvery flower (diploied) 1	1.854
	CNS0095599	Silvery flower (diploied) 2	0.868
	CNS0095600	Silvery flower (diploied) 3	1.675
	CNS0095601	Golden flower (diploid) 1	0.622
	CNS0095602	Golden flower (diploid) 2	2.600
	CNS0095603	Golden flower (diploid) 3	1.324
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.944
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.615
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.654
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.180
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.166
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.581
	CNS0095610	Silvery flower (tetraploid) 1	0.504
	CNS0095611	Silvery flower (tetraploid) 2	0.387
	CNS0095612	Silvery flower (tetraploid) 3	0.599
	CNS0095613	Golden flower (tetraploid) 1	0.156
	CNS0095614	Golden flower (tetraploid) 2	0.942
	CNS0095615	Golden flower (tetraploid) 3	0.376
CRA001975	CRR073297	Stem 1	5.185
	CRR073298	Stem 2	3.103
	CRR073299	Stem 3	5.409
	CRR073300	Leaf 1	4.246
	CRR073301	Leaf 2	3.184
	CRR073302	Leaf 3	2.102
	CRR073303	Juvenile bud 1	4.790
	CRR073304	Juvenile bud 2	2.602
	CRR073305	Juvenile bud 3	4.357
	CRR073306	Third green 1	0.802
	CRR073307	Third green 2	0.380
	CRR073308	Third green 3	0.329
	CRR073309	Second white 1	2.456
	CRR073310	Second white 2	1.301
	CRR073311	Second white 3	1.681
	CRR073312	Silver flowering 1	1.539
	CRR073313	Silver flowering 2	1.748
	CRR073314	Silver flowering 3	1.013
	CRR073315	Gold flowering 1	2.676
	CRR073316	Gold flowering 2	1.328
	CRR073317	Gold flowering 3	2.133
	CRR073318	Tawny withering 1	3.732
	CRR073319	Tawny withering 2	2.062
	CRR073320	Tawny withering 3	2.348