Gene detail

Detail information of GWHGAAZE030915

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KHG18378.1	2.11058E-64	hypothetical protein F383_01388 [Gossypium arboreum]
Swissprot	tr\|Q9C944\|H2AV3_ARATH	4E-63	Probable histone H2A variant 3
trEMBL	tr\|B9RUZ2\|B9RUZ2_RICCO	1E-64	Histone H2A {ECO:0000256\|RuleBase:RU003556}
TAIR10	AT1G52740.1	9E-50	histone H2A protein 9

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	50352851	50353153	+
GWHAAZE00000009	mRNA	50352851	50353153	+
GWHAAZE00000009	exon	50352851	50353153	+
GWHAAZE00000009	CDS	50352851	50353153	+

Transcript Sequence
>GWHTAAZE030949 ATGCAGTTCCCAGTGGGTAGGGTTCACCGCTTGCTGAAGACTAGGGTTTCTGCGAATGGAAGGGTAGGAGCAACAGCTGCGGTGTACACCGCAGCAATATTGGAGTACCTGACTGCAGAAGTGCTGGAGTTGGCTGGTAATGCTAGCAAGGATCTTAAGGTCAAGCGAATAACCCCCAGGCATTTGCAGCTAGCCATCAGGGGAGACGAAGAACTCGATACCCTCATCAAAGGAACAATTGCTGGTGGCGGTGTTATACCCCACATCCACAAGTCTCTCATCAACAAGTCTTCCAAGGAGTAA

Network for GWHGAAZE030915

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00125.25	Histone	2	69	1.50E-16
PF16211.6	Histone_H2A_C	70	99	4.80E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11251	H2A	Necroptosis	map04217

Gene Ontology

GO term	Ontology	Name
GO:0000786	cellular_component	nucleosome
GO:0005634	cellular_component	nucleus
GO:0003677	molecular_function	DNA binding
GO:0046982	molecular_function	protein heterodimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	32.842
	SRR3591706	second leaf	38.837
	SRR3591707	mature leaf	42.836
	SRR3591708	Shoot apex	92.389
	SRR3591709	Stem	49.730
	SRR3591710	White floral bud	33.386
	SRR3591711	White flower	39.676
	SRR3591712	Green floral bud	21.179
	SRR3591713	Yellow flower	43.772
SRP173429	SRR8316895	Juvenile bud stage	26.352
	SRR8316896	Juvenile bud stage	25.294
	SRR8316897	Juvenile bud stage	12.359
	SRR8316894	Third green stage	7.011
	SRR8316900	Third green stage	13.328
	SRR8316901	Third green stage	11.571
	SRR8316898	Complete white stage	2.991
	SRR8316899	Complete white stage	20.432
	SRR8316903	Complete white stage	8.302
	SRR8316902	Silver flowering stage	9.514
	SRR8316904	Silver flowering stage	5.746
	SRR8316905	Silver flowering stage	3.763
	SRR8316906	Gold flowering stage	16.212
	SRR8316907	Gold flowering stage	18.085
	SRR8316908	Gold flowering stage	20.133
SRP132670	SRR6706286	Control	24.370
	SRR6706287	Light intensity 50%	22.204
	SRR6706288	Light intensity 20%	20.763
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	35.741
	CNS0095593	Slightly white alabastrum(diploid) 2	30.232
	CNS0095594	Slightly white alabastrum(diploid) 3	38.956
	CNS0095595	Whole white alabastrum(diploid) 2	24.966
	CNS0095596	Whole white alabastrum(diploid) 3	21.461
	CNS0095597	Whole white alabastrum(diploid) 4	20.609
	CNS0095598	Silvery flower (diploied) 1	73.485
	CNS0095599	Silvery flower (diploied) 2	48.338
	CNS0095600	Silvery flower (diploied) 3	37.116
	CNS0095601	Golden flower (diploid) 1	47.445
	CNS0095602	Golden flower (diploid) 2	43.459
	CNS0095603	Golden flower (diploid) 3	43.457
	CNS0095604	Slightly white alabastrum(tetraploid) 1	32.200
	CNS0095605	Slightly white alabastrum(tetraploid) 2	34.711
	CNS0095606	Slightly white alabastrum(tetraploid) 3	52.593
	CNS0095607	Whole white alabastrum(tetraploid) 1	24.731
	CNS0095608	Whole white alabastrum(tetraploid) 2	18.307
	CNS0095609	Whole white alabastrum(tetraploid) 3	20.085
	CNS0095610	Silvery flower (tetraploid) 1	35.111
	CNS0095611	Silvery flower (tetraploid) 2	47.617
	CNS0095612	Silvery flower (tetraploid) 3	20.178
	CNS0095613	Golden flower (tetraploid) 1	41.098
	CNS0095614	Golden flower (tetraploid) 2	42.126
	CNS0095615	Golden flower (tetraploid) 3	33.043
CRA001975	CRR073297	Stem 1	35.689
	CRR073298	Stem 2	21.442
	CRR073299	Stem 3	41.200
	CRR073300	Leaf 1	17.221
	CRR073301	Leaf 2	19.818
	CRR073302	Leaf 3	20.105
	CRR073303	Juvenile bud 1	10.463
	CRR073304	Juvenile bud 2	14.046
	CRR073305	Juvenile bud 3	14.610
	CRR073306	Third green 1	4.597
	CRR073307	Third green 2	2.473
	CRR073308	Third green 3	6.878
	CRR073309	Second white 1	9.366
	CRR073310	Second white 2	4.340
	CRR073311	Second white 3	1.767
	CRR073312	Silver flowering 1	3.038
	CRR073313	Silver flowering 2	6.615
	CRR073314	Silver flowering 3	0.904
	CRR073315	Gold flowering 1	64.368
	CRR073316	Gold flowering 2	72.233
	CRR073317	Gold flowering 3	63.084
	CRR073318	Tawny withering 1	56.271
	CRR073319	Tawny withering 2	46.597
	CRR073320	Tawny withering 3	55.441