Gene detail

Detail information of GWHGAAZE030975

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011072430.1	2.75022E-58	PREDICTED: histidine-containing phosphotransfer protein 4-like [Sesamum indicum]
Swissprot	tr\|Q9LU15\|AHP4_ARATH	3E-45	Histidine-containing phosphotransfer protein 4
trEMBL	tr\|A0A0A0KB29\|A0A0A0KB29_CUCSA	7E-58	Uncharacterized protein {ECO:0000313\|EMBL:KGN45582.1}
TAIR10	AT3G16360.2	8E-41	HPT phosphotransmitter 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	51261140	51262215	+
GWHAAZE00000009	mRNA	51261140	51262215	+
GWHAAZE00000009	exon	51261140	51261184	+
GWHAAZE00000009	exon	51261636	51261766	+
GWHAAZE00000009	exon	51261937	51262005	+
GWHAAZE00000009	exon	51262140	51262215	+
GWHAAZE00000009	CDS	51261140	51261184	+
GWHAAZE00000009	CDS	51261636	51261766	+
GWHAAZE00000009	CDS	51261937	51262005	+
GWHAAZE00000009	CDS	51262140	51262215	+

Transcript Sequence
>GWHTAAZE031009 ATGCATCGACAACTTGCTAACGTGAGGAAGTCCCTTTTCGATCAGGGATTTGTAGACGAACAATTCGTTCAGTTGGAGGAGTTGGAGGACGAAGCTAACCCTAATTTTGTGGAGGAAGTAGTTGCTTCCTACTATCGCGATTCAGGCCGCCTAATCCTCAATATAGAGCAAGCACTGGAGAAGAGTCCTCTTGATTTTACTAAATTGGACAGCTATATGCAACAATTCAAGGGCAGAAGCTCAAGCATCGGCGCCAAAAAGGTGAAAATTGAATGCACACAATTCAGGGAATACTGCAAGGCTGGAAATGGAGAAGGGTAA

Network for GWHGAAZE030975

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14490	AHP	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0000160	biological_process	phosphorelay signal transduction system

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.184
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.200
	SRR3591709	Stem	3.097
	SRR3591710	White floral bud	1.927
	SRR3591711	White flower	3.253
	SRR3591712	Green floral bud	1.918
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	2.329
	SRR8316896	Juvenile bud stage	2.248
	SRR8316897	Juvenile bud stage	0.941
	SRR8316894	Third green stage	1.010
	SRR8316900	Third green stage	1.863
	SRR8316901	Third green stage	3.925
	SRR8316898	Complete white stage	1.867
	SRR8316899	Complete white stage	5.006
	SRR8316903	Complete white stage	8.102
	SRR8316902	Silver flowering stage	3.389
	SRR8316904	Silver flowering stage	2.963
	SRR8316905	Silver flowering stage	1.084
	SRR8316906	Gold flowering stage	4.658
	SRR8316907	Gold flowering stage	1.545
	SRR8316908	Gold flowering stage	6.334
SRP132670	SRR6706286	Control	1.004
	SRR6706287	Light intensity 50%	2.256
	SRR6706288	Light intensity 20%	1.549
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.698
	CNS0095593	Slightly white alabastrum(diploid) 2	10.999
	CNS0095594	Slightly white alabastrum(diploid) 3	4.785
	CNS0095595	Whole white alabastrum(diploid) 2	4.065
	CNS0095596	Whole white alabastrum(diploid) 3	5.701
	CNS0095597	Whole white alabastrum(diploid) 4	9.295
	CNS0095598	Silvery flower (diploied) 1	0.863
	CNS0095599	Silvery flower (diploied) 2	2.491
	CNS0095600	Silvery flower (diploied) 3	0.574
	CNS0095601	Golden flower (diploid) 1	0.118
	CNS0095602	Golden flower (diploid) 2	0.671
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.426
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.686
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.226
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.849
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.404
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.811
	CNS0095610	Silvery flower (tetraploid) 1	2.335
	CNS0095611	Silvery flower (tetraploid) 2	0.184
	CNS0095612	Silvery flower (tetraploid) 3	1.776
	CNS0095613	Golden flower (tetraploid) 1	0.376
	CNS0095614	Golden flower (tetraploid) 2	0.247
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.748
	CRR073298	Stem 2	2.784
	CRR073299	Stem 3	0.782
	CRR073300	Leaf 1	4.771
	CRR073301	Leaf 2	7.636
	CRR073302	Leaf 3	3.466
	CRR073303	Juvenile bud 1	9.107
	CRR073304	Juvenile bud 2	7.919
	CRR073305	Juvenile bud 3	2.440
	CRR073306	Third green 1	0.488
	CRR073307	Third green 2	2.981
	CRR073308	Third green 3	2.153
	CRR073309	Second white 1	0.704
	CRR073310	Second white 2	1.208
	CRR073311	Second white 3	0.300
	CRR073312	Silver flowering 1	0.839
	CRR073313	Silver flowering 2	0.459
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.981
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.293
	CRR073320	Tawny withering 3	0.000