Gene detail

Detail information of GWHGAAZE031049

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006465927.1	2.57002E-84	PREDICTED: transcription initiation factor TFIID subunit 12b-like [Citrus sinensis]
Swissprot	tr\|B2C6R6\|TAFCL_ARATH	9E-52	Transcription initiation factor TFIID subunit 12b
trEMBL	tr\|A0A061GJJ3\|A0A061GJJ3_THECC	6E-84	Transcription initiation factor TFIID subunit A isoform 1 {ECO:0000313\|EMBL:EOY27229.1}
TAIR10	AT1G17440.2	1E-33	Transcription initiation factor TFIID subunit A

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	52296032	52297416	+
GWHAAZE00000009	mRNA	52296032	52297416	+
GWHAAZE00000009	exon	52296032	52296520	+
GWHAAZE00000009	exon	52296876	52296950	+
GWHAAZE00000009	exon	52297208	52297286	+
GWHAAZE00000009	exon	52297412	52297416	+
GWHAAZE00000009	CDS	52296032	52296520	+
GWHAAZE00000009	CDS	52296876	52296950	+
GWHAAZE00000009	CDS	52297208	52297286	+
GWHAAZE00000009	CDS	52297412	52297416	+

Transcript Sequence
>GWHTAAZE031083 GCGCAAAGCCTAACAAGGTCATCATTTATGAACCCCCAGTTATCTGGGTTGGCCCAAAATGGACAACCAGCTATGATCCAGAACACGTTGTCACAGCAACAATGGTTGAAGCAGCAAATGCCAACAATGTCTAATCCTAATTCTCCTTCATACCGTCTTCAACAACAGAGGCAACAAGCACTTTTGCAGCAGCAACTAGCTTCATCTCCTCAGTTACACCAAAATTCTATGACTTTAAACACACAGCAGTTGCCTCAAATTGTACAGCAGCAGCAACAAATGGCACATCCACAGCAGCAGCAGCAACAGCAACAGCAGCAGTCGCCTAGGATGGCTGCACCGGCAGGCCAAAAATCGCTAAGTTTGACTGGATCACAGCCAGATGCTACTGCATCTGGAACAACTACACCCGGGGGGAGTTCAAGTCAAGGAACAGAAGGAAGCAATCAACTTCTTGGGAAAAGGAAGATAAAGGATTTGGTTTCCCAGGTCGACCCACAAGGAACGCTGGATCCCGAAGTTGAAGATATTCTTTTGGAGATTGCTGATGACTTCATCGACTTGGTTACTACACATGCATGCAGTTTGGCGAAACATCGGAAGTCTTCAACTCTGGAGTCCAAGGATGTATTACTACACCTAGGTTGA

Network for GWHGAAZE031049

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0273

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03847.14	TFIID_20kDa	153	214	4.40E-27

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03126	TAF12	Basal transcription factors	map03022

Gene Ontology

GO term	Ontology	Name
GO:0006352	biological_process	DNA-templated transcription, initiation
GO:0005669	cellular_component	transcription factor TFIID complex
GO:0046982	molecular_function	protein heterodimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	24.645
	SRR3591706	second leaf	18.259
	SRR3591707	mature leaf	20.980
	SRR3591708	Shoot apex	24.981
	SRR3591709	Stem	31.266
	SRR3591710	White floral bud	35.532
	SRR3591711	White flower	34.024
	SRR3591712	Green floral bud	40.802
	SRR3591713	Yellow flower	29.235
SRP173429	SRR8316895	Juvenile bud stage	14.547
	SRR8316896	Juvenile bud stage	18.593
	SRR8316897	Juvenile bud stage	9.559
	SRR8316894	Third green stage	10.168
	SRR8316900	Third green stage	23.534
	SRR8316901	Third green stage	26.050
	SRR8316898	Complete white stage	7.870
	SRR8316899	Complete white stage	43.806
	SRR8316903	Complete white stage	27.159
	SRR8316902	Silver flowering stage	13.943
	SRR8316904	Silver flowering stage	20.363
	SRR8316905	Silver flowering stage	9.980
	SRR8316906	Gold flowering stage	32.245
	SRR8316907	Gold flowering stage	27.102
	SRR8316908	Gold flowering stage	31.757
SRP132670	SRR6706286	Control	55.942
	SRR6706287	Light intensity 50%	56.556
	SRR6706288	Light intensity 20%	54.500
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.101
	CNS0095593	Slightly white alabastrum(diploid) 2	16.385
	CNS0095594	Slightly white alabastrum(diploid) 3	11.885
	CNS0095595	Whole white alabastrum(diploid) 2	15.187
	CNS0095596	Whole white alabastrum(diploid) 3	10.669
	CNS0095597	Whole white alabastrum(diploid) 4	15.793
	CNS0095598	Silvery flower (diploied) 1	19.917
	CNS0095599	Silvery flower (diploied) 2	11.495
	CNS0095600	Silvery flower (diploied) 3	32.959
	CNS0095601	Golden flower (diploid) 1	14.143
	CNS0095602	Golden flower (diploid) 2	32.560
	CNS0095603	Golden flower (diploid) 3	29.128
	CNS0095604	Slightly white alabastrum(tetraploid) 1	17.274
	CNS0095605	Slightly white alabastrum(tetraploid) 2	15.130
	CNS0095606	Slightly white alabastrum(tetraploid) 3	39.326
	CNS0095607	Whole white alabastrum(tetraploid) 1	10.374
	CNS0095608	Whole white alabastrum(tetraploid) 2	9.197
	CNS0095609	Whole white alabastrum(tetraploid) 3	18.978
	CNS0095610	Silvery flower (tetraploid) 1	29.984
	CNS0095611	Silvery flower (tetraploid) 2	36.239
	CNS0095612	Silvery flower (tetraploid) 3	32.899
	CNS0095613	Golden flower (tetraploid) 1	16.083
	CNS0095614	Golden flower (tetraploid) 2	26.258
	CNS0095615	Golden flower (tetraploid) 3	32.346
CRA001975	CRR073297	Stem 1	49.475
	CRR073298	Stem 2	40.127
	CRR073299	Stem 3	31.711
	CRR073300	Leaf 1	43.941
	CRR073301	Leaf 2	48.045
	CRR073302	Leaf 3	36.897
	CRR073303	Juvenile bud 1	35.493
	CRR073304	Juvenile bud 2	25.440
	CRR073305	Juvenile bud 3	64.543
	CRR073306	Third green 1	13.240
	CRR073307	Third green 2	12.073
	CRR073308	Third green 3	17.943
	CRR073309	Second white 1	12.714
	CRR073310	Second white 2	15.641
	CRR073311	Second white 3	12.122
	CRR073312	Silver flowering 1	16.695
	CRR073313	Silver flowering 2	13.501
	CRR073314	Silver flowering 3	13.923
	CRR073315	Gold flowering 1	26.774
	CRR073316	Gold flowering 2	46.050
	CRR073317	Gold flowering 3	32.785
	CRR073318	Tawny withering 1	41.238
	CRR073319	Tawny withering 2	29.446
	CRR073320	Tawny withering 3	39.218