Gene detail

Detail information of GWHGAAZE031051

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007024617.1	6.62451E-93	Myb domain protein 23 [Theobroma cacao]
Swissprot	tr\|Q9SEI0\|WER_ARATH	2E-55	Transcription factor WER
trEMBL	tr\|A0A061GJK0\|A0A061GJK0_THECC	2E-93	Myb domain protein 23 {ECO:0000313\|EMBL:EOY27239.1}
TAIR10	AT5G14750.1	6E-45	myb domain protein 66

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	52302805	52303840	-
GWHAAZE00000009	mRNA	52302805	52303840	-
GWHAAZE00000009	exon	52303702	52303840	-
GWHAAZE00000009	exon	52303391	52303520	-
GWHAAZE00000009	exon	52302805	52303138	-
GWHAAZE00000009	CDS	52303702	52303840	-
GWHAAZE00000009	CDS	52303391	52303520	-
GWHAAZE00000009	CDS	52302817	52303138	-
GWHAAZE00000009	three_prime_UTR	52302805	52302816	-

Transcript Sequence
>GWHTAAZE031085 ATGGAATCTGTTACAAATGTATCAGTTAAGAAGAAAGAAGTAAACAAGGGAGCATGGACAGCCGAAGAAGATCGAAAACTAGCTGAAGCTATTGAAGTCCATGGTGCAAAGAGGTGGAAGATTATTGCAACCAAAGCAGGTCTGAAACGATGCGGAAAGAGTTGCAGGCTAAGATGGATGAATTATCTGAGACCCAACATCAAGAGAGGCAATATATCAGACCAAGAAGAGGACTTAATTCTCAGGCTTCATAAACTCCTAGGAAACAGGTGGTCATTGATTGCGGGGAGACTACCGGGTCGCACAGACAACGAAATAAAGAACTACTGGAATTCTCATTTGAGCAAGAAGATGAACCAGAAAGATAAACAAAGTGAAAGCTCGAAAAGAGAAGGCTCCACATCTCTGAGAAGAAAGGTCACAGAGAAGGCCAGTGAAGAAGTGAGAGATAATGAGGACGACTCCATTAACAATACTAATGGTGGTCAAGATGAAAATTTTAGCTTCAATGTAGATGATTTCTTTGATTTCTCTAATGAGGACCATTTGACTTTGGAGTGGCCGGGTCAAGTGACTTCACGAACTCAATGATGGCTTATGTGA

Network for GWHGAAZE031051

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00249.32	Myb_DNA-binding	16	63	1.10E-16
PF00249.32	Myb_DNA-binding	69	114	1.10E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MYB

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.836
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	2.289
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.284
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	1.314
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	2.677
	SRR8316896	Juvenile bud stage	4.493
	SRR8316897	Juvenile bud stage	3.392
	SRR8316894	Third green stage	1.459
	SRR8316900	Third green stage	3.519
	SRR8316901	Third green stage	5.812
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	9.453
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.061
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	2.561
	SRR6706287	Light intensity 50%	3.248
	SRR6706288	Light intensity 20%	3.849
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.216
	CNS0095593	Slightly white alabastrum(diploid) 2	5.265
	CNS0095594	Slightly white alabastrum(diploid) 3	4.267
	CNS0095595	Whole white alabastrum(diploid) 2	1.394
	CNS0095596	Whole white alabastrum(diploid) 3	1.482
	CNS0095597	Whole white alabastrum(diploid) 4	1.398
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.134
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.372
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.926
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.839
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.919
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.696
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.726
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	1.697
	CRR073298	Stem 2	1.353
	CRR073299	Stem 3	1.010
	CRR073300	Leaf 1	1.681
	CRR073301	Leaf 2	2.434
	CRR073302	Leaf 3	0.281
	CRR073303	Juvenile bud 1	0.640
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	2.052
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.003
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.531
	CRR073320	Tawny withering 3	0.000