Gene detail

Detail information of GWHGAAZE031060

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002299587.2	5.1599E-100	TATA BINDING protein ASSOCIATED FACTOR 21KDA SUBUNIT [Populus trichocarpa]
Swissprot	tr\|Q9SYH2\|TAF9_ARATH	3E-80	Transcription initiation factor TFIID subunit 9
trEMBL	tr\|B9GKT8\|B9GKT8_POPTR	2E-100	TATA BINDING protein ASSOCIATED FACTOR 21KDA SUBUNIT {ECO:0000313\|EMBL:EEE84392.2}
TAIR10	AT1G54140.1	2E-63	TATA binding protein associated factor 21kDa subunit

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	52416611	52418027	+
GWHAAZE00000009	mRNA	52416611	52418027	+
GWHAAZE00000009	exon	52416611	52416868	+
GWHAAZE00000009	exon	52417749	52418027	+
GWHAAZE00000009	CDS	52416611	52416868	+
GWHAAZE00000009	CDS	52417749	52418027	+

Transcript Sequence
>GWHTAAZE031094 ATGGCAGAGGAAGATGAGAACTTGCCAAGGGATGCAAAGATTGTTAAAACACTGCTCAAATCAATGGGTGTTGATGATTATGAACCTCGTGTTATACACCAATTCCTAGAACTGTGGTATCGCTACGTTGTTGATGTATTGACAGATTCTCAGGTGTACTCAGAGCATGCTGGGAAGGCTACGATTGACTCTGACGATGTCAAGCTTGCTATTCAGTCAAAAGTTAACTTCAGCTTTTCACAACCCCCACCTCGAGAGGTGCTACTAGAGTTGGCCAGAAGCAGGAACAAAATCCCGTTGCCCAAGTCATTGGTGGGGCCTGGGATCCCACTTCCTCCCGAGCAGGATACGTTGATAAGGCCCAACTACCAACTTGCGATTCCAAAGAAGCGAAGTTCCGAAGCAGTGGAAGAAACAGAGGAGGATGAAGATGGTGTTGATCGCCATCCCAATCTGTCCCAACAACAGAAGACAGAGTTGCCACAAAATACTCCTCAGCGGGTTTCCTTCCCTCTCGGGGCTAAAAGGCCAAGATGA

Network for GWHGAAZE031060

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02291.16	TFIID-31kDa	6	125	3.60E-46

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03133	TAF9B, TAF9	Basal transcription factors	map03022

Gene Ontology

GO term	Ontology	Name
GO:0006352	biological_process	DNA-templated transcription, initiation
GO:0046982	molecular_function	protein heterodimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	16.900
	SRR3591706	second leaf	10.643
	SRR3591707	mature leaf	16.253
	SRR3591708	Shoot apex	20.258
	SRR3591709	Stem	22.226
	SRR3591710	White floral bud	20.308
	SRR3591711	White flower	27.611
	SRR3591712	Green floral bud	23.486
	SRR3591713	Yellow flower	31.105
SRP173429	SRR8316895	Juvenile bud stage	11.926
	SRR8316896	Juvenile bud stage	16.832
	SRR8316897	Juvenile bud stage	13.813
	SRR8316894	Third green stage	4.781
	SRR8316900	Third green stage	15.056
	SRR8316901	Third green stage	16.524
	SRR8316898	Complete white stage	10.317
	SRR8316899	Complete white stage	25.710
	SRR8316903	Complete white stage	13.486
	SRR8316902	Silver flowering stage	16.137
	SRR8316904	Silver flowering stage	14.231
	SRR8316905	Silver flowering stage	9.236
	SRR8316906	Gold flowering stage	41.588
	SRR8316907	Gold flowering stage	40.772
	SRR8316908	Gold flowering stage	61.440
SRP132670	SRR6706286	Control	14.786
	SRR6706287	Light intensity 50%	16.439
	SRR6706288	Light intensity 20%	15.721
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.570
	CNS0095593	Slightly white alabastrum(diploid) 2	16.187
	CNS0095594	Slightly white alabastrum(diploid) 3	14.256
	CNS0095595	Whole white alabastrum(diploid) 2	13.730
	CNS0095596	Whole white alabastrum(diploid) 3	15.776
	CNS0095597	Whole white alabastrum(diploid) 4	12.870
	CNS0095598	Silvery flower (diploied) 1	19.755
	CNS0095599	Silvery flower (diploied) 2	13.617
	CNS0095600	Silvery flower (diploied) 3	23.251
	CNS0095601	Golden flower (diploid) 1	21.415
	CNS0095602	Golden flower (diploid) 2	24.868
	CNS0095603	Golden flower (diploid) 3	29.005
	CNS0095604	Slightly white alabastrum(tetraploid) 1	32.602
	CNS0095605	Slightly white alabastrum(tetraploid) 2	29.270
	CNS0095606	Slightly white alabastrum(tetraploid) 3	36.488
	CNS0095607	Whole white alabastrum(tetraploid) 1	20.832
	CNS0095608	Whole white alabastrum(tetraploid) 2	25.811
	CNS0095609	Whole white alabastrum(tetraploid) 3	21.089
	CNS0095610	Silvery flower (tetraploid) 1	50.030
	CNS0095611	Silvery flower (tetraploid) 2	49.880
	CNS0095612	Silvery flower (tetraploid) 3	43.057
	CNS0095613	Golden flower (tetraploid) 1	51.299
	CNS0095614	Golden flower (tetraploid) 2	41.178
	CNS0095615	Golden flower (tetraploid) 3	75.198
CRA001975	CRR073297	Stem 1	18.990
	CRR073298	Stem 2	17.896
	CRR073299	Stem 3	19.769
	CRR073300	Leaf 1	19.813
	CRR073301	Leaf 2	16.786
	CRR073302	Leaf 3	16.214
	CRR073303	Juvenile bud 1	17.388
	CRR073304	Juvenile bud 2	15.350
	CRR073305	Juvenile bud 3	23.078
	CRR073306	Third green 1	25.084
	CRR073307	Third green 2	23.156
	CRR073308	Third green 3	25.288
	CRR073309	Second white 1	22.586
	CRR073310	Second white 2	20.586
	CRR073311	Second white 3	19.978
	CRR073312	Silver flowering 1	23.500
	CRR073313	Silver flowering 2	21.952
	CRR073314	Silver flowering 3	12.885
	CRR073315	Gold flowering 1	22.916
	CRR073316	Gold flowering 2	24.173
	CRR073317	Gold flowering 3	18.468
	CRR073318	Tawny withering 1	29.417
	CRR073319	Tawny withering 2	15.652
	CRR073320	Tawny withering 3	27.475