Gene detail

Detail information of GWHGAAZE031066

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010033246.1	1.70973E-92	PREDICTED: protein SEC13 homolog [Eucalyptus grandis]
COG	YP_007119786.1	4E-11	WD40 repeat-containing protein
Swissprot	tr\|O64740\|SC13B_ARATH	3E-82	Protein transport protein SEC13 homolog B {ECO:0000305}
trEMBL	tr\|A0A059AG71\|A0A059AG71_EUCGR	6E-93	Uncharacterized protein {ECO:0000313\|EMBL:KCW52833.1}
TAIR10	AT2G30050.1	4E-67	transducin family protein / WD-40 repeat family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	52482958	52483670	-
GWHAAZE00000009	mRNA	52482958	52483670	-
GWHAAZE00000009	exon	52482958	52483373	-
GWHAAZE00000009	exon	52483451	52483670	-
GWHAAZE00000009	CDS	52483451	52483670	-
GWHAAZE00000009	CDS	52482958	52483373	-

Transcript Sequence
>GWHTAAZE031100 ATGCCTTCGCAAAAGATTGAAACTGGTCACCAATATGCAGTCCATGATGTGGCAATGGATTACTATGGCAAGTGTGTCGCAACAGCATCTTCAGACAACACCGTTAAGATGATTGGGGTGAGCAACTCGGCCTCTCAGCATCTCACAAACATTTGTCTCTGCTTGGCATGTGGATCTTCGGATGGAAATATCTCTGTTTACACTGCAAGATCCGATGGTGGTGCTCTTGTTGGTTCTGGCTTAAATGATCCCGTTCAGAAGCTTGTGTCTGGTGGGTGTGATAGTACGGTCAGAGTGTGGAAGCATTACAACGGGGTTTGGAAAATGGATTGTTTCCCTGCTCTTCAAATACATACGGATTGGGTCCGTGATGTTGCTTGGGCACCCAACTTGGGGCTGCCTAAATATACTATTGCGAGTGCCTTTGAAGATGGAAGAGTTATCATATGGACTGAGGCTAAGGAAGGGGATCAGTGGGACGGTAAGGTTTTGAAGGATTTAGAGACCCCTGTTTGGAGGGTGTCTTGGTCGTTAATGGGAAACATACTGGCCGTGGCTGATGGGAAAAACAATGTTACCTTGTGGAAAGAAGCAGTAGATGGTGAGTGGCAACATGTGACAACAGTTGAGTCGTAA

Network for GWHGAAZE031066

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00400.33	WD40	8	37	0.022
PF00400.33	WD40	115	150	0.27

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	DWD

KEGG pathway

KO	Enzyme	pathway	mapID
K14004	SEC13	RNA transport	map03013
		Protein processing in endoplasmic reticulum	map04141
		mTOR signaling pathway	map04150

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.308
	SRR3591706	second leaf	1.012
	SRR3591707	mature leaf	1.647
	SRR3591708	Shoot apex	3.287
	SRR3591709	Stem	3.065
	SRR3591710	White floral bud	0.698
	SRR3591711	White flower	1.732
	SRR3591712	Green floral bud	2.415
	SRR3591713	Yellow flower	0.187
SRP173429	SRR8316895	Juvenile bud stage	1.107
	SRR8316896	Juvenile bud stage	2.249
	SRR8316897	Juvenile bud stage	1.171
	SRR8316894	Third green stage	0.472
	SRR8316900	Third green stage	0.935
	SRR8316901	Third green stage	1.157
	SRR8316898	Complete white stage	0.088
	SRR8316899	Complete white stage	1.846
	SRR8316903	Complete white stage	0.341
	SRR8316902	Silver flowering stage	0.287
	SRR8316904	Silver flowering stage	0.081
	SRR8316905	Silver flowering stage	0.020
	SRR8316906	Gold flowering stage	0.722
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.117
SRP132670	SRR6706286	Control	1.085
	SRR6706287	Light intensity 50%	0.890
	SRR6706288	Light intensity 20%	1.224
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.545
	CNS0095593	Slightly white alabastrum(diploid) 2	0.356
	CNS0095594	Slightly white alabastrum(diploid) 3	1.209
	CNS0095595	Whole white alabastrum(diploid) 2	1.256
	CNS0095596	Whole white alabastrum(diploid) 3	1.374
	CNS0095597	Whole white alabastrum(diploid) 4	0.464
	CNS0095598	Silvery flower (diploied) 1	1.766
	CNS0095599	Silvery flower (diploied) 2	6.576
	CNS0095600	Silvery flower (diploied) 3	0.811
	CNS0095601	Golden flower (diploid) 1	1.667
	CNS0095602	Golden flower (diploid) 2	1.273
	CNS0095603	Golden flower (diploid) 3	1.863
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.285
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.214
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.531
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.496
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.360
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.393
	CNS0095610	Silvery flower (tetraploid) 1	0.260
	CNS0095611	Silvery flower (tetraploid) 2	0.202
	CNS0095612	Silvery flower (tetraploid) 3	0.158
	CNS0095613	Golden flower (tetraploid) 1	0.153
	CNS0095614	Golden flower (tetraploid) 2	0.421
	CNS0095615	Golden flower (tetraploid) 3	0.109
CRA001975	CRR073297	Stem 1	0.790
	CRR073298	Stem 2	2.007
	CRR073299	Stem 3	0.602
	CRR073300	Leaf 1	2.322
	CRR073301	Leaf 2	2.185
	CRR073302	Leaf 3	0.640
	CRR073303	Juvenile bud 1	0.286
	CRR073304	Juvenile bud 2	1.843
	CRR073305	Juvenile bud 3	0.776
	CRR073306	Third green 1	0.356
	CRR073307	Third green 2	0.182
	CRR073308	Third green 3	0.872
	CRR073309	Second white 1	0.342
	CRR073310	Second white 2	0.377
	CRR073311	Second white 3	0.062
	CRR073312	Silver flowering 1	0.473
	CRR073313	Silver flowering 2	0.124
	CRR073314	Silver flowering 3	0.254
	CRR073315	Gold flowering 1	1.920
	CRR073316	Gold flowering 2	0.765
	CRR073317	Gold flowering 3	1.034
	CRR073318	Tawny withering 1	1.146
	CRR073319	Tawny withering 2	2.984
	CRR073320	Tawny withering 3	1.246