Gene detail

Detail information of GWHGAAZE031099

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002299587.2	1.7856E-99	TATA BINDING protein ASSOCIATED FACTOR 21KDA SUBUNIT [Populus trichocarpa]
Swissprot	tr\|Q9SYH2\|TAF9_ARATH	1E-79	Transcription initiation factor TFIID subunit 9
trEMBL	tr\|B9GKT8\|B9GKT8_POPTR	7E-100	TATA BINDING protein ASSOCIATED FACTOR 21KDA SUBUNIT {ECO:0000313\|EMBL:EEE84392.2}
TAIR10	AT1G54140.1	3E-63	TATA binding protein associated factor 21kDa subunit

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	53198046	53199546	+
GWHAAZE00000009	mRNA	53198046	53199546	+
GWHAAZE00000009	exon	53198046	53198381	+
GWHAAZE00000009	exon	53199268	53199546	+
GWHAAZE00000009	CDS	53198046	53198381	+
GWHAAZE00000009	CDS	53199268	53199546	+

Transcript Sequence
>GWHTAAZE031133 CGCACTACAATTCTTCTTGAGTGGTCTAACAACTGCAAATATGGCTTCTTATGCAGGAAAGAAGGTACATTTTACAAAATGGCAGAGGAAGATGAGAACTTGCCAAGGGATGCAAAGATTGTTAAAACACTGCTCAAATCAATGGGTGTTGATGATTACGAACCTCGTGTTATACACCAATTCCTAGAACTGTGGTATCGCTATGTTGTTGATGTATTGACAGATTCTCAGGTGTACTCCGAGCATGCTGGGAAGGCTACGATTGACTCTGATGATGTCAAGCTTGCTATTCAGTCAAAAGTTAACTTCAGCTTTTCACAACCCCCACCTCGAGAGGTGCTACTAGAGTTGGCCAGAAGCAGGAACAAAATCCCGTTGCCCAAGTCATTGGTGGGGCCTGGGATCCCACTTCCTCCCGAGCAGGATACGTTGATAAGGCCCAACTACCAACTTGCGATTCCAAAGAAGCGAAGTTCCGAAGCAGTGGAAGAAACAGAGGAGGATGAAGATGGTGTTGATCGCCATCCCAATCTGTCCCAACAACAGAAGACAGAGTTGCCACAAAATACTCCTCAGCGGGTTTCCTTCCCTCTTGGGGCTAAAAGGCCAAGATGA

Network for GWHGAAZE031099

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02291.16	TFIID-31kDa	32	151	5.40E-46

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03133	TAF9B, TAF9	Basal transcription factors	map03022

Gene Ontology

GO term	Ontology	Name
GO:0006352	biological_process	DNA-templated transcription, initiation
GO:0046982	molecular_function	protein heterodimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	17.427
	SRR3591706	second leaf	12.396
	SRR3591707	mature leaf	13.059
	SRR3591708	Shoot apex	20.039
	SRR3591709	Stem	17.872
	SRR3591710	White floral bud	10.280
	SRR3591711	White flower	15.248
	SRR3591712	Green floral bud	11.801
	SRR3591713	Yellow flower	19.610
SRP173429	SRR8316895	Juvenile bud stage	8.983
	SRR8316896	Juvenile bud stage	12.152
	SRR8316897	Juvenile bud stage	3.203
	SRR8316894	Third green stage	5.282
	SRR8316900	Third green stage	13.600
	SRR8316901	Third green stage	14.600
	SRR8316898	Complete white stage	7.735
	SRR8316899	Complete white stage	21.842
	SRR8316903	Complete white stage	7.276
	SRR8316902	Silver flowering stage	8.694
	SRR8316904	Silver flowering stage	9.111
	SRR8316905	Silver flowering stage	4.860
	SRR8316906	Gold flowering stage	20.593
	SRR8316907	Gold flowering stage	24.235
	SRR8316908	Gold flowering stage	18.067
SRP132670	SRR6706286	Control	11.489
	SRR6706287	Light intensity 50%	11.137
	SRR6706288	Light intensity 20%	11.558
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.558
	CNS0095593	Slightly white alabastrum(diploid) 2	12.994
	CNS0095594	Slightly white alabastrum(diploid) 3	13.641
	CNS0095595	Whole white alabastrum(diploid) 2	10.982
	CNS0095596	Whole white alabastrum(diploid) 3	11.629
	CNS0095597	Whole white alabastrum(diploid) 4	11.277
	CNS0095598	Silvery flower (diploied) 1	17.745
	CNS0095599	Silvery flower (diploied) 2	12.972
	CNS0095600	Silvery flower (diploied) 3	15.674
	CNS0095601	Golden flower (diploid) 1	13.228
	CNS0095602	Golden flower (diploid) 2	18.175
	CNS0095603	Golden flower (diploid) 3	15.878
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.156
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.812
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.904
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.285
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.042
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.447
	CNS0095610	Silvery flower (tetraploid) 1	4.204
	CNS0095611	Silvery flower (tetraploid) 2	1.694
	CNS0095612	Silvery flower (tetraploid) 3	1.588
	CNS0095613	Golden flower (tetraploid) 1	2.911
	CNS0095614	Golden flower (tetraploid) 2	3.305
	CNS0095615	Golden flower (tetraploid) 3	2.062
CRA001975	CRR073297	Stem 1	10.703
	CRR073298	Stem 2	14.526
	CRR073299	Stem 3	14.699
	CRR073300	Leaf 1	11.158
	CRR073301	Leaf 2	14.426
	CRR073302	Leaf 3	16.193
	CRR073303	Juvenile bud 1	13.469
	CRR073304	Juvenile bud 2	13.555
	CRR073305	Juvenile bud 3	13.334
	CRR073306	Third green 1	9.829
	CRR073307	Third green 2	11.335
	CRR073308	Third green 3	8.363
	CRR073309	Second white 1	12.064
	CRR073310	Second white 2	9.639
	CRR073311	Second white 3	9.045
	CRR073312	Silver flowering 1	10.382
	CRR073313	Silver flowering 2	9.722
	CRR073314	Silver flowering 3	7.051
	CRR073315	Gold flowering 1	12.539
	CRR073316	Gold flowering 2	17.100
	CRR073317	Gold flowering 3	7.522
	CRR073318	Tawny withering 1	17.216
	CRR073319	Tawny withering 2	13.948
	CRR073320	Tawny withering 3	18.114