Gene detail

Detail information of GWHGAAZE031170

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDO97722.1	7.35592E-84	unnamed protein product [Coffea canephora]
trEMBL	tr\|A0A068TP02\|A0A068TP02_COFCA	3E-84	Coffea canephora DH200=94 genomic scaffold, scaffold_2 {ECO:0000313\|EMBL:CDO97722.1}
TAIR10	AT3G20270.3	3E-27	lipid-binding serum glycoprotein family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	54251181	54254312	+
GWHAAZE00000009	mRNA	54251181	54254312	+
GWHAAZE00000009	exon	54251181	54251434	+
GWHAAZE00000009	exon	54253867	54253969	+
GWHAAZE00000009	exon	54254145	54254312	+
GWHAAZE00000009	CDS	54251181	54251434	+
GWHAAZE00000009	CDS	54253867	54253969	+
GWHAAZE00000009	CDS	54254145	54254312	+

Transcript Sequence
>GWHTAAZE031204 ATGACAGATGAAGGCAAAAGTTCATCTTTGCTATCTTCCTGGTGTCCTTTTGGGAAGCTTCCTGATCATCTACTGATAGAAATCTTCATCAGGGTTCCCATCTCAGAGTGGGGGCAAGTATCTTGCGTTAAGAAGCAGTGGGCTAATCTGTTTCGGGAAGAATGCTTGTGGCATGCTGCCCTTGTCAGGAGTTTTCCCTTGGCTGGCCAAGCTAAAGGCTGGCCAGGTCCTATCCCTCGAGGACTGAGCAAAAGGGCCCATGATCTCACCTCAAAGATCTGGTTGGCTGTAATTGACAATTTGGAGGAAACTGAAAGAACATTTCATTTACTTAAACGTCTTGCACTGGAGGGGGATGTATTTCTACCATATCCATACTCGAGATCGTACAAGGTGCAGTGGAGGATTTTTGAAAAGCTGTTTACAGATTTCCGCGATTGCTTCAATCGAGTGGACTACTACGATGTGTTGGGATGTGCCAAGCAGAAATTTCAGCCCATACCATCCGCCTGGTTAGGATACTAG

Network for GWHGAAZE031170

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF12937.8	F-box-like	19	59	7.90E-07

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	F-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	11.493
	SRR3591706	second leaf	20.848
	SRR3591707	mature leaf	31.462
	SRR3591708	Shoot apex	19.222
	SRR3591709	Stem	25.512
	SRR3591710	White floral bud	21.382
	SRR3591711	White flower	35.714
	SRR3591712	Green floral bud	16.819
	SRR3591713	Yellow flower	36.229
SRP173429	SRR8316895	Juvenile bud stage	12.110
	SRR8316896	Juvenile bud stage	16.839
	SRR8316897	Juvenile bud stage	9.322
	SRR8316894	Third green stage	8.114
	SRR8316900	Third green stage	17.078
	SRR8316901	Third green stage	17.792
	SRR8316898	Complete white stage	11.203
	SRR8316899	Complete white stage	26.369
	SRR8316903	Complete white stage	15.117
	SRR8316902	Silver flowering stage	18.522
	SRR8316904	Silver flowering stage	19.964
	SRR8316905	Silver flowering stage	10.331
	SRR8316906	Gold flowering stage	44.492
	SRR8316907	Gold flowering stage	36.120
	SRR8316908	Gold flowering stage	34.798
SRP132670	SRR6706286	Control	25.547
	SRR6706287	Light intensity 50%	24.110
	SRR6706288	Light intensity 20%	23.591
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	16.395
	CNS0095593	Slightly white alabastrum(diploid) 2	17.554
	CNS0095594	Slightly white alabastrum(diploid) 3	18.855
	CNS0095595	Whole white alabastrum(diploid) 2	17.541
	CNS0095596	Whole white alabastrum(diploid) 3	15.163
	CNS0095597	Whole white alabastrum(diploid) 4	15.369
	CNS0095598	Silvery flower (diploied) 1	29.973
	CNS0095599	Silvery flower (diploied) 2	23.982
	CNS0095600	Silvery flower (diploied) 3	28.488
	CNS0095601	Golden flower (diploid) 1	29.329
	CNS0095602	Golden flower (diploid) 2	29.109
	CNS0095603	Golden flower (diploid) 3	27.779
	CNS0095604	Slightly white alabastrum(tetraploid) 1	16.378
	CNS0095605	Slightly white alabastrum(tetraploid) 2	15.805
	CNS0095606	Slightly white alabastrum(tetraploid) 3	20.761
	CNS0095607	Whole white alabastrum(tetraploid) 1	17.007
	CNS0095608	Whole white alabastrum(tetraploid) 2	15.594
	CNS0095609	Whole white alabastrum(tetraploid) 3	19.821
	CNS0095610	Silvery flower (tetraploid) 1	53.402
	CNS0095611	Silvery flower (tetraploid) 2	50.988
	CNS0095612	Silvery flower (tetraploid) 3	29.438
	CNS0095613	Golden flower (tetraploid) 1	37.595
	CNS0095614	Golden flower (tetraploid) 2	37.384
	CNS0095615	Golden flower (tetraploid) 3	38.800
CRA001975	CRR073297	Stem 1	16.314
	CRR073298	Stem 2	14.157
	CRR073299	Stem 3	10.250
	CRR073300	Leaf 1	13.379
	CRR073301	Leaf 2	15.119
	CRR073302	Leaf 3	8.282
	CRR073303	Juvenile bud 1	7.896
	CRR073304	Juvenile bud 2	6.083
	CRR073305	Juvenile bud 3	10.087
	CRR073306	Third green 1	4.816
	CRR073307	Third green 2	7.286
	CRR073308	Third green 3	9.033
	CRR073309	Second white 1	10.361
	CRR073310	Second white 2	11.739
	CRR073311	Second white 3	9.830
	CRR073312	Silver flowering 1	7.322
	CRR073313	Silver flowering 2	5.273
	CRR073314	Silver flowering 3	7.782
	CRR073315	Gold flowering 1	25.727
	CRR073316	Gold flowering 2	25.242
	CRR073317	Gold flowering 3	14.906
	CRR073318	Tawny withering 1	14.958
	CRR073319	Tawny withering 2	13.791
	CRR073320	Tawny withering 3	14.596