Gene detail

Detail information of GWHGAAZE031197

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP09365.1	7.20368E-62	unnamed protein product [Coffea canephora]
COG	YP_159199.1	7E-10	50S ribosomal protein L18
trEMBL	tr\|A0A068ULF3\|A0A068ULF3_COFCA	3E-62	Coffea canephora DH200=94 genomic scaffold, scaffold_38 {ECO:0000313\|EMBL:CDP09365.1}
TAIR10	AT3G20230.1	4E-44	Ribosomal L18p/L5e family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	54838853	54839158	+
GWHAAZE00000009	mRNA	54838853	54839158	+
GWHAAZE00000009	exon	54838853	54839158	+
GWHAAZE00000009	CDS	54838853	54839158	+

Transcript Sequence
>GWHTAAZE031231 ATGTACATGAGACCATTTCTCTTAAACGTCTTCTTTTCAAAGCGATTCGTACATGCAAAAGTGATGCATAGGGGAACCAGCAAGGTGATATCAGTCGCCACCACGAATTCCAAAGATCTAAGGAACACATTACCGTCCCTCGTTGACGTAAATGCTTGTCGAGTTATAGGGAAGTTGATTGCAGAGCGATCAAAGGAAGCTGATGTGTTTGCAATGTCTTATGAGCCTGGGAAGAATGAGCGGATCGAGGGGAGACTTGGGATTGTTCTCGATACAATTAAGGAGAATGGTATTATCTTCGTTTGA

Network for GWHGAAZE031197

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00861.23	Ribosomal_L18p	8	100	7.90E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02881	RP-L18, MRPL18, rplR	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	17.915
	SRR3591706	second leaf	24.028
	SRR3591707	mature leaf	24.682
	SRR3591708	Shoot apex	23.722
	SRR3591709	Stem	13.906
	SRR3591710	White floral bud	20.143
	SRR3591711	White flower	30.568
	SRR3591712	Green floral bud	42.347
	SRR3591713	Yellow flower	25.969
SRP173429	SRR8316895	Juvenile bud stage	19.638
	SRR8316896	Juvenile bud stage	17.158
	SRR8316897	Juvenile bud stage	12.556
	SRR8316894	Third green stage	8.477
	SRR8316900	Third green stage	43.486
	SRR8316901	Third green stage	33.231
	SRR8316898	Complete white stage	8.943
	SRR8316899	Complete white stage	34.774
	SRR8316903	Complete white stage	15.047
	SRR8316902	Silver flowering stage	7.931
	SRR8316904	Silver flowering stage	15.575
	SRR8316905	Silver flowering stage	7.590
	SRR8316906	Gold flowering stage	23.410
	SRR8316907	Gold flowering stage	22.693
	SRR8316908	Gold flowering stage	23.923
SRP132670	SRR6706286	Control	22.755
	SRR6706287	Light intensity 50%	27.257
	SRR6706288	Light intensity 20%	34.734
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	23.107
	CNS0095593	Slightly white alabastrum(diploid) 2	27.775
	CNS0095594	Slightly white alabastrum(diploid) 3	14.107
	CNS0095595	Whole white alabastrum(diploid) 2	25.525
	CNS0095596	Whole white alabastrum(diploid) 3	25.375
	CNS0095597	Whole white alabastrum(diploid) 4	27.726
	CNS0095598	Silvery flower (diploied) 1	19.959
	CNS0095599	Silvery flower (diploied) 2	14.021
	CNS0095600	Silvery flower (diploied) 3	27.598
	CNS0095601	Golden flower (diploid) 1	24.983
	CNS0095602	Golden flower (diploid) 2	27.290
	CNS0095603	Golden flower (diploid) 3	24.674
	CNS0095604	Slightly white alabastrum(tetraploid) 1	21.372
	CNS0095605	Slightly white alabastrum(tetraploid) 2	23.396
	CNS0095606	Slightly white alabastrum(tetraploid) 3	28.368
	CNS0095607	Whole white alabastrum(tetraploid) 1	14.427
	CNS0095608	Whole white alabastrum(tetraploid) 2	19.563
	CNS0095609	Whole white alabastrum(tetraploid) 3	32.190
	CNS0095610	Silvery flower (tetraploid) 1	35.906
	CNS0095611	Silvery flower (tetraploid) 2	36.412
	CNS0095612	Silvery flower (tetraploid) 3	32.313
	CNS0095613	Golden flower (tetraploid) 1	33.065
	CNS0095614	Golden flower (tetraploid) 2	39.365
	CNS0095615	Golden flower (tetraploid) 3	12.122
CRA001975	CRR073297	Stem 1	22.844
	CRR073298	Stem 2	25.766
	CRR073299	Stem 3	29.680
	CRR073300	Leaf 1	26.928
	CRR073301	Leaf 2	30.122
	CRR073302	Leaf 3	31.633
	CRR073303	Juvenile bud 1	34.112
	CRR073304	Juvenile bud 2	32.547
	CRR073305	Juvenile bud 3	23.396
	CRR073306	Third green 1	4.209
	CRR073307	Third green 2	3.201
	CRR073308	Third green 3	3.789
	CRR073309	Second white 1	11.879
	CRR073310	Second white 2	10.314
	CRR073311	Second white 3	7.993
	CRR073312	Silver flowering 1	10.159
	CRR073313	Silver flowering 2	7.169
	CRR073314	Silver flowering 3	11.789
	CRR073315	Gold flowering 1	79.895
	CRR073316	Gold flowering 2	63.004
	CRR073317	Gold flowering 3	46.791
	CRR073318	Tawny withering 1	7.711
	CRR073319	Tawny withering 2	14.403
	CRR073320	Tawny withering 3	14.493