Gene detail

Detail information of GWHGAAZE031286

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010037474.1	6.97318E-35	PREDICTED: putative F-box/LRR-repeat protein At5g02700 [Eucalyptus grandis]
Swissprot	tr\|Q9LJF8\|FBL47_ARATH	8E-14	F-box/LRR-repeat protein At3g26922
trEMBL	tr\|A0A059A618\|A0A059A618_EUCGR	3E-35	Uncharacterized protein {ECO:0000313\|EMBL:KCW49184.1}
TAIR10	AT3G26922.1	3E-12	F-box/RNI-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	56596864	56597630	+
GWHAAZE00000009	mRNA	56596864	56597630	+
GWHAAZE00000009	exon	56596864	56597019	+
GWHAAZE00000009	exon	56597148	56597630	+
GWHAAZE00000009	five_prime_UTR	56596864	56596980	+
GWHAAZE00000009	CDS	56596981	56597019	+
GWHAAZE00000009	CDS	56597148	56597630	+

Transcript Sequence
>GWHTAAZE031320 ATTTTGTAACTGCAGCTAACTTTGTTTTTTTTTGCAGGTTACAATAACTTATTAAGGAATAATTCCTTTTCTACAATCAGATCAGTAGGGGCTGTTTGGTTTGGATCAATCTATCTAATGGTGAAAAGTTTGAATCTCACTTCTAAATTACAGAAGTGTAGTAGGAGCAAAGATGTGTCTTTGCCTGATCGGATTAGTGAATTGCCCGAGGAAATTCTTATCAATATTTTGTCCCTCCTGACGCTGAGAGAAGCTGTGCGTACCAGTGTTGTCTCTCATAGATGGAAGAACTTGTGGACATATACCACTGGTAGCTTGGACTTTGAATTTGTGGATCAAGATATGGCAACCTACTTAAGCAGGGTGAACAAAATCTTGAACTCGCACCAGGGTGCCACCATCGACGAATTTAGAGTCAAATTCGATTGGCAGATAAGAGCTAGATCAGATATTGATAGTTGGCTTAATTTTGCCCTACGTAAGAGAGTGCAAAGGCTTGAACTAGACTTGGACGGAGTTAGAGCAAGCTGGGACGACCGCTACCCTTTTTTTGCGGCACCATCTCATGGCTCGAATAACAACATCAATAATTTCAGTTGCTTGAGAAGCCTGAATTTGACCCATGTAGACGTGAGTTGA

Network for GWHGAAZE031286

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00646.34	F-box	25	60	3.00E-08

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	F-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.967
	SRR3591706	second leaf	2.822
	SRR3591707	mature leaf	2.578
	SRR3591708	Shoot apex	4.426
	SRR3591709	Stem	1.969
	SRR3591710	White floral bud	0.740
	SRR3591711	White flower	1.213
	SRR3591712	Green floral bud	1.769
	SRR3591713	Yellow flower	0.516
SRP173429	SRR8316895	Juvenile bud stage	0.268
	SRR8316896	Juvenile bud stage	0.095
	SRR8316897	Juvenile bud stage	0.650
	SRR8316894	Third green stage	0.376
	SRR8316900	Third green stage	0.686
	SRR8316901	Third green stage	1.085
	SRR8316898	Complete white stage	0.338
	SRR8316899	Complete white stage	1.034
	SRR8316903	Complete white stage	0.325
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.325
	SRR8316905	Silver flowering stage	0.130
	SRR8316906	Gold flowering stage	0.579
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.589
SRP132670	SRR6706286	Control	0.800
	SRR6706287	Light intensity 50%	0.630
	SRR6706288	Light intensity 20%	0.852
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.555
	CNS0095593	Slightly white alabastrum(diploid) 2	0.287
	CNS0095594	Slightly white alabastrum(diploid) 3	0.235
	CNS0095595	Whole white alabastrum(diploid) 2	0.373
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.274
	CNS0095598	Silvery flower (diploied) 1	1.531
	CNS0095599	Silvery flower (diploied) 2	0.054
	CNS0095600	Silvery flower (diploied) 3	0.631
	CNS0095601	Golden flower (diploid) 1	1.272
	CNS0095602	Golden flower (diploid) 2	0.295
	CNS0095603	Golden flower (diploid) 3	0.555
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.298
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.272
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.441
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.925
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.257
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.239
	CNS0095610	Silvery flower (tetraploid) 1	3.184
	CNS0095611	Silvery flower (tetraploid) 2	5.310
	CNS0095612	Silvery flower (tetraploid) 3	3.762
	CNS0095613	Golden flower (tetraploid) 1	2.277
	CNS0095614	Golden flower (tetraploid) 2	3.135
	CNS0095615	Golden flower (tetraploid) 3	2.085
CRA001975	CRR073297	Stem 1	0.335
	CRR073298	Stem 2	0.517
	CRR073299	Stem 3	0.372
	CRR073300	Leaf 1	1.046
	CRR073301	Leaf 2	0.706
	CRR073302	Leaf 3	0.567
	CRR073303	Juvenile bud 1	0.635
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.208
	CRR073306	Third green 1	0.112
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.037
	CRR073311	Second white 3	0.096
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.157
	CRR073316	Gold flowering 2	0.082
	CRR073317	Gold flowering 3	0.733
	CRR073318	Tawny withering 1	0.148
	CRR073319	Tawny withering 2	1.034
	CRR073320	Tawny withering 3	0.452