Gene detail

Detail information of GWHGAAZE031403

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004138498.1	1.22699E-35	PREDICTED: cytochrome P450 86A2-like [Cucumis sativus]
Swissprot	tr\|O80823\|C86A8_ARATH	6E-35	Cytochrome P450 86A8
trEMBL	tr\|A0A0A0K9Z1\|A0A0A0K9Z1_CUCSA	5E-36	Uncharacterized protein {ECO:0000313\|EMBL:KGN45664.1}
TAIR10	AT2G45970.1	2E-30	cytochrome P450, family 86, subfamily A, polypeptide 8

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	58440782	58441150	-
GWHAAZE00000009	mRNA	58440782	58441150	-
GWHAAZE00000009	exon	58440782	58441150	-
GWHAAZE00000009	CDS	58440782	58441150	-

Transcript Sequence
>GWHTAAZE031439 ATGTACGACTCTTATAGATTCGTGGCATTCAATGCGGGGCCGAGGATTTGTTTGGGGAAGGATTTGGCGTATCTTCAAATGAGATCGATCGCAGTGGCTGTGCTCTTGCGCCACCATCTGACATTGGCGGCCAGCCACCGCGTCGAGCAAAAGATGTCGCTGACACTGTTTATGAAGTACGGGCTTGAAGTGGAAGTGCACTGTAGGGATTTAACTACGATTTTGAGGAGTATGAAGTGGGAAAGAGAAAACGAGTCCCGTGGCAAAGGGAATTCTCCAGGAAAAGGTGAGGGGGTGAATTTGGTGGTGGAGCATAAAATGTTGTTTGTGGTTGTTGGTTTGTCCATAGGTGTAAATAGACATGGATGA

Network for GWHGAAZE031403

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	4	55	7.70E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K15398	CYP86A4S	Metabolic pathways	map01100
K15398	CYP86A4S	Cutin, suberine and wax biosynthesis	map00073

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.677
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	1.244
	SRR3591708	Shoot apex	1.210
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.503
	SRR3591711	White flower	0.317
	SRR3591712	Green floral bud	0.325
	SRR3591713	Yellow flower	0.267
SRP173429	SRR8316895	Juvenile bud stage	0.684
	SRR8316896	Juvenile bud stage	0.311
	SRR8316897	Juvenile bud stage	0.835
	SRR8316894	Third green stage	0.503
	SRR8316900	Third green stage	0.793
	SRR8316901	Third green stage	0.554
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.388
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.269
	SRR8316904	Silver flowering stage	0.093
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.223
SRP132670	SRR6706286	Control	0.775
	SRR6706287	Light intensity 50%	0.465
	SRR6706288	Light intensity 20%	0.477
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.188
	CNS0095593	Slightly white alabastrum(diploid) 2	0.430
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.222
	CNS0095597	Whole white alabastrum(diploid) 4	0.141
	CNS0095598	Silvery flower (diploied) 1	1.108
	CNS0095599	Silvery flower (diploied) 2	0.056
	CNS0095600	Silvery flower (diploied) 3	0.272
	CNS0095601	Golden flower (diploid) 1	0.421
	CNS0095602	Golden flower (diploid) 2	0.484
	CNS0095603	Golden flower (diploid) 3	0.746
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.093
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.354
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.386
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.131
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.796
	CNS0095610	Silvery flower (tetraploid) 1	0.142
	CNS0095611	Silvery flower (tetraploid) 2	0.296
	CNS0095612	Silvery flower (tetraploid) 3	0.439
	CNS0095613	Golden flower (tetraploid) 1	0.343
	CNS0095614	Golden flower (tetraploid) 2	0.139
	CNS0095615	Golden flower (tetraploid) 3	0.172
CRA001975	CRR073297	Stem 1	0.774
	CRR073298	Stem 2	1.184
	CRR073299	Stem 3	0.176
	CRR073300	Leaf 1	0.291
	CRR073301	Leaf 2	0.705
	CRR073302	Leaf 3	0.111
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.732
	CRR073311	Second white 3	0.143
	CRR073312	Silver flowering 1	0.221
	CRR073313	Silver flowering 2	0.553
	CRR073314	Silver flowering 3	0.411
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.274
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.384
	CRR073319	Tawny withering 2	0.477
	CRR073320	Tawny withering 3	0.011