Gene detail

Detail information of GWHGAAZE031475

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007218447.1	1.3477E-136	hypothetical protein PRUPE_ppa011750mg [Prunus persica]
COG	NP_988462.1	0.0000005	hypothetical protein MMP1342
trEMBL	tr\|M5X2D5\|M5X2D5_PRUPE	5E-137	Uncharacterized protein {ECO:0000313\|EMBL:EMJ19646.1}
TAIR10	AT2G46230.1	1E-93	PIN domain-like family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	59421407	59425469	+
GWHAAZE00000009	mRNA	59421407	59425469	+
GWHAAZE00000009	exon	59421407	59421477	+
GWHAAZE00000009	exon	59421574	59421639	+
GWHAAZE00000009	exon	59421739	59421844	+
GWHAAZE00000009	exon	59422904	59422946	+
GWHAAZE00000009	exon	59423073	59423145	+
GWHAAZE00000009	exon	59423395	59423482	+
GWHAAZE00000009	exon	59424251	59424307	+
GWHAAZE00000009	exon	59424396	59424474	+
GWHAAZE00000009	exon	59425456	59425469	+
GWHAAZE00000009	CDS	59421407	59421477	+
GWHAAZE00000009	CDS	59421574	59421639	+
GWHAAZE00000009	CDS	59421739	59421844	+
GWHAAZE00000009	CDS	59422904	59422946	+
GWHAAZE00000009	CDS	59423073	59423145	+
GWHAAZE00000009	CDS	59423395	59423482	+
GWHAAZE00000009	CDS	59424251	59424307	+
GWHAAZE00000009	CDS	59424396	59424474	+
GWHAAZE00000009	CDS	59425456	59425469	+

Transcript Sequence
>GWHTAAZE031511 ATGGGGAAAGCAAGGAAATCTCCCAAATTTGCTGTCATGAAGAAGATTATCACTTCAAAAGCAATTAAACAACATAAAGAAGAGGTATTGAACCCTAACAAGAAAGATTTGCAGAAGGAAAAGCTCCCGAGAAACGTACCAAATGTTTCTTCGGCTCTTTTCTTCACTCATAATACTGCATTGGGACCGCCTTATCGAGTTTTGGTCGATACCAATTTCATTAATTTCTCCATTCAGAATAAATTGGATTTGGAGAAAGGGATGATGGATTGCTTATACGCCAAATGCACTCCATGTATCACTGATTGTGTGATGGCGGAGCTTGAGAAGCTAGGCCAGAAGTACCGTGTTGCTTTGAGAATTGCTAAGGATCCTCGATTTGAAAGACTTCCATGCACTCATAAAGGAACATACGCTGATGACTGTATTGTTGAGAGAGTTACTCAGCACAAGTGCTATATGGTGGCAACATGTGATCGAGATCTAAAGAGAAGGATACGCAAGATCCCTGGTGTGCCAATCATGTACATTACTAAACACAAGTATTCAATTGAGCGCTTGCCCGAGGCGACAATTGGTGGAGCCCCAAGATTTTGA

Network for GWHGAAZE031475

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04900.13	Fcf1	90	186	7.80E-40

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14566	UTP24, FCF1	Ribosome biogenesis in eukaryotes	map03008

Gene Ontology

GO term	Ontology	Name
GO:0032040	cellular_component	small-subunit processome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	20.273
	SRR3591706	second leaf	16.311
	SRR3591707	mature leaf	20.320
	SRR3591708	Shoot apex	32.471
	SRR3591709	Stem	23.513
	SRR3591710	White floral bud	27.242
	SRR3591711	White flower	45.933
	SRR3591712	Green floral bud	37.685
	SRR3591713	Yellow flower	34.559
SRP173429	SRR8316895	Juvenile bud stage	25.762
	SRR8316896	Juvenile bud stage	27.692
	SRR8316897	Juvenile bud stage	19.775
	SRR8316894	Third green stage	13.610
	SRR8316900	Third green stage	35.794
	SRR8316901	Third green stage	31.098
	SRR8316898	Complete white stage	9.751
	SRR8316899	Complete white stage	37.812
	SRR8316903	Complete white stage	11.740
	SRR8316902	Silver flowering stage	9.926
	SRR8316904	Silver flowering stage	10.681
	SRR8316905	Silver flowering stage	5.211
	SRR8316906	Gold flowering stage	16.901
	SRR8316907	Gold flowering stage	12.766
	SRR8316908	Gold flowering stage	18.364
SRP132670	SRR6706286	Control	15.188
	SRR6706287	Light intensity 50%	14.661
	SRR6706288	Light intensity 20%	16.434
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	23.756
	CNS0095593	Slightly white alabastrum(diploid) 2	28.714
	CNS0095594	Slightly white alabastrum(diploid) 3	30.437
	CNS0095595	Whole white alabastrum(diploid) 2	18.843
	CNS0095596	Whole white alabastrum(diploid) 3	22.277
	CNS0095597	Whole white alabastrum(diploid) 4	13.629
	CNS0095598	Silvery flower (diploied) 1	19.207
	CNS0095599	Silvery flower (diploied) 2	17.370
	CNS0095600	Silvery flower (diploied) 3	20.166
	CNS0095601	Golden flower (diploid) 1	13.242
	CNS0095602	Golden flower (diploid) 2	21.697
	CNS0095603	Golden flower (diploid) 3	17.852
	CNS0095604	Slightly white alabastrum(tetraploid) 1	23.331
	CNS0095605	Slightly white alabastrum(tetraploid) 2	17.249
	CNS0095606	Slightly white alabastrum(tetraploid) 3	30.722
	CNS0095607	Whole white alabastrum(tetraploid) 1	10.395
	CNS0095608	Whole white alabastrum(tetraploid) 2	9.688
	CNS0095609	Whole white alabastrum(tetraploid) 3	20.270
	CNS0095610	Silvery flower (tetraploid) 1	26.661
	CNS0095611	Silvery flower (tetraploid) 2	21.185
	CNS0095612	Silvery flower (tetraploid) 3	15.596
	CNS0095613	Golden flower (tetraploid) 1	14.250
	CNS0095614	Golden flower (tetraploid) 2	22.684
	CNS0095615	Golden flower (tetraploid) 3	12.830
CRA001975	CRR073297	Stem 1	13.804
	CRR073298	Stem 2	13.844
	CRR073299	Stem 3	19.186
	CRR073300	Leaf 1	13.925
	CRR073301	Leaf 2	14.173
	CRR073302	Leaf 3	18.557
	CRR073303	Juvenile bud 1	14.259
	CRR073304	Juvenile bud 2	8.938
	CRR073305	Juvenile bud 3	14.385
	CRR073306	Third green 1	2.614
	CRR073307	Third green 2	2.035
	CRR073308	Third green 3	3.281
	CRR073309	Second white 1	8.332
	CRR073310	Second white 2	6.858
	CRR073311	Second white 3	4.610
	CRR073312	Silver flowering 1	3.449
	CRR073313	Silver flowering 2	5.018
	CRR073314	Silver flowering 3	3.113
	CRR073315	Gold flowering 1	16.581
	CRR073316	Gold flowering 2	14.642
	CRR073317	Gold flowering 3	9.698
	CRR073318	Tawny withering 1	12.710
	CRR073319	Tawny withering 2	14.280
	CRR073320	Tawny withering 3	17.550