Gene detail

Detail information of GWHGAAZE031583

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO85353.1	1.55152E-36	hypothetical protein CISIN_1g042716mg, partial [Citrus sinensis]
Swissprot	tr\|Q8VXX4\|RFC3_ARATH	2E-12	Replication factor C subunit 3
trEMBL	tr\|A0A067H039\|A0A067H039_CITSI	6E-37	Uncharacterized protein {ECO:0000313\|EMBL:KDO85353.1} (Fragment)
TAIR10	AT5G27740.1	1E-10	ATPase family associated with various cellular activities (AAA)

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	61216100	61216618	-
GWHAAZE00000009	mRNA	61216100	61216618	-
GWHAAZE00000009	exon	61216100	61216240	-
GWHAAZE00000009	exon	61216526	61216618	-
GWHAAZE00000009	CDS	61216526	61216618	-
GWHAAZE00000009	CDS	61216100	61216240	-

Transcript Sequence
>GWHTAAZE031619 ATGGTCTTCTTTTGCTGCAATGACATCTCAAGGCTTCAGCCAATTAAGTCGCTTTGCACTGTAATTCAACTTCTTCCACCTTCTAATGAAGAGATTGTTGAAGTGTTGGAATTCATAGCAAAACAAGAAGGTATAAAATTGCCATGCCAGTTGGCTGAGAAAATCACAAACAACTCGAAGAATAATTTACGACAAGCCATACGTTCCTTTGAAGCTACCTGGCAATCCAAGTAA

Network for GWHGAAZE031583

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K10756	RFC3_5	DNA replication	map03030
		Nucleotide excision repair	map03420
		Mismatch repair	map03430

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.235
	SRR3591706	second leaf	0.356
	SRR3591707	mature leaf	0.421
	SRR3591708	Shoot apex	0.723
	SRR3591709	Stem	1.565
	SRR3591710	White floral bud	0.090
	SRR3591711	White flower	0.798
	SRR3591712	Green floral bud	0.188
	SRR3591713	Yellow flower	1.282
SRP173429	SRR8316895	Juvenile bud stage	0.238
	SRR8316896	Juvenile bud stage	0.594
	SRR8316897	Juvenile bud stage	0.227
	SRR8316894	Third green stage	0.454
	SRR8316900	Third green stage	0.591
	SRR8316901	Third green stage	0.889
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.150
	SRR8316903	Complete white stage	0.587
	SRR8316902	Silver flowering stage	0.182
	SRR8316904	Silver flowering stage	0.563
	SRR8316905	Silver flowering stage	0.173
	SRR8316906	Gold flowering stage	0.633
	SRR8316907	Gold flowering stage	1.411
	SRR8316908	Gold flowering stage	0.756
SRP132670	SRR6706286	Control	0.037
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.001
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.190
	CNS0095593	Slightly white alabastrum(diploid) 2	1.221
	CNS0095594	Slightly white alabastrum(diploid) 3	0.984
	CNS0095595	Whole white alabastrum(diploid) 2	0.447
	CNS0095596	Whole white alabastrum(diploid) 3	0.871
	CNS0095597	Whole white alabastrum(diploid) 4	1.195
	CNS0095598	Silvery flower (diploied) 1	0.608
	CNS0095599	Silvery flower (diploied) 2	0.307
	CNS0095600	Silvery flower (diploied) 3	0.897
	CNS0095601	Golden flower (diploid) 1	0.335
	CNS0095602	Golden flower (diploid) 2	1.483
	CNS0095603	Golden flower (diploid) 3	0.473
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.566
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.165
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.690
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.376
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.549
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.519
	CNS0095610	Silvery flower (tetraploid) 1	0.996
	CNS0095611	Silvery flower (tetraploid) 2	2.087
	CNS0095612	Silvery flower (tetraploid) 3	2.192
	CNS0095613	Golden flower (tetraploid) 1	1.838
	CNS0095614	Golden flower (tetraploid) 2	2.762
	CNS0095615	Golden flower (tetraploid) 3	0.749
CRA001975	CRR073297	Stem 1	0.465
	CRR073298	Stem 2	0.967
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.779
	CRR073301	Leaf 2	0.869
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.146
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.154
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.084