Gene detail

Detail information of GWHGAAZE031587

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP09308.1	5.3929E-57	unnamed protein product [Coffea canephora]
Swissprot	tr\|O81097\|RPB8A_ARATH	4E-43	DNA-directed RNA polymerases II and V subunit 8A
trEMBL	tr\|A0A068UNW5\|A0A068UNW5_COFCA	2E-57	Coffea canephora DH200=94 genomic scaffold, scaffold_38 {ECO:0000313\|EMBL:CDP09308.1}
TAIR10	AT1G54250.1	7E-35	RNA polymerase Rpb8

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	61259612	61262165	-
GWHAAZE00000009	mRNA	61259612	61262165	-
GWHAAZE00000009	exon	61259612	61259723	-
GWHAAZE00000009	exon	61260365	61260459	-
GWHAAZE00000009	exon	61260981	61261156	-
GWHAAZE00000009	exon	61262093	61262165	-
GWHAAZE00000009	CDS	61262093	61262165	-
GWHAAZE00000009	CDS	61260981	61261156	-
GWHAAZE00000009	CDS	61260365	61260459	-
GWHAAZE00000009	CDS	61259612	61259723	-

Transcript Sequence
>GWHTAAZE031623 ATGGTTGAACTTTACTTCGACGATATCATTGAGGTTGATCGGTTGGATCCTGATGGTAAAAAATATGATAAAGCTAATAAATTGTGCCTGTACTTTTCAGTTTCTCGCATAGATGCTCATAGTGAGGAAGATGACATGCATTTACTACTAGACGTGAACACTGAATTATATCCTATTAGTGCTGGGGAGAAGTTTAGGTTGGCGTTAACTCAAACGCTAAGTTTGAATGGGTCAGCTGTTACTCCTGAAGGTAAGCAGAAATCACTTGCAGACAAATTCGAGTATGTAATGCATGGGCTGTTATATAAGATCGCAGAGGACACCTCAGAAGCTAATCTTCAAGTGGTGATATATATTTCATTTGGAGGACTACAACTGATGCTGAAAGGGGAACCCTCAAAGATGGGAAAATTTAAGGTTGATCAGAAGTTGTTTCTTCTAATGAGGAAGGTTTGA

Network for GWHGAAZE031587

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03870.16	RNA_pol_Rpb8	7	150	1.40E-42

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03016	RPB8, POLR2H	RNA polymerase	map03020
K03016	RPB8, POLR2H	Cytosolic DNA-sensing pathway	map04623

Gene Ontology

GO term	Ontology	Name
GO:0006351	biological_process	transcription, DNA-templated

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	47.482
	SRR3591706	second leaf	25.210
	SRR3591707	mature leaf	34.933
	SRR3591708	Shoot apex	65.275
	SRR3591709	Stem	45.990
	SRR3591710	White floral bud	27.597
	SRR3591711	White flower	43.444
	SRR3591712	Green floral bud	39.627
	SRR3591713	Yellow flower	38.970
SRP173429	SRR8316895	Juvenile bud stage	34.426
	SRR8316896	Juvenile bud stage	45.227
	SRR8316897	Juvenile bud stage	22.370
	SRR8316894	Third green stage	19.847
	SRR8316900	Third green stage	60.154
	SRR8316901	Third green stage	51.280
	SRR8316898	Complete white stage	11.080
	SRR8316899	Complete white stage	61.210
	SRR8316903	Complete white stage	23.688
	SRR8316902	Silver flowering stage	14.224
	SRR8316904	Silver flowering stage	15.527
	SRR8316905	Silver flowering stage	9.487
	SRR8316906	Gold flowering stage	36.682
	SRR8316907	Gold flowering stage	33.886
	SRR8316908	Gold flowering stage	42.427
SRP132670	SRR6706286	Control	2.147
	SRR6706287	Light intensity 50%	3.345
	SRR6706288	Light intensity 20%	4.693
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	47.686
	CNS0095593	Slightly white alabastrum(diploid) 2	56.322
	CNS0095594	Slightly white alabastrum(diploid) 3	45.837
	CNS0095595	Whole white alabastrum(diploid) 2	46.072
	CNS0095596	Whole white alabastrum(diploid) 3	38.552
	CNS0095597	Whole white alabastrum(diploid) 4	41.076
	CNS0095598	Silvery flower (diploied) 1	55.351
	CNS0095599	Silvery flower (diploied) 2	43.118
	CNS0095600	Silvery flower (diploied) 3	39.477
	CNS0095601	Golden flower (diploid) 1	43.356
	CNS0095602	Golden flower (diploid) 2	34.440
	CNS0095603	Golden flower (diploid) 3	34.665
	CNS0095604	Slightly white alabastrum(tetraploid) 1	41.855
	CNS0095605	Slightly white alabastrum(tetraploid) 2	38.294
	CNS0095606	Slightly white alabastrum(tetraploid) 3	65.829
	CNS0095607	Whole white alabastrum(tetraploid) 1	25.536
	CNS0095608	Whole white alabastrum(tetraploid) 2	23.705
	CNS0095609	Whole white alabastrum(tetraploid) 3	44.197
	CNS0095610	Silvery flower (tetraploid) 1	34.965
	CNS0095611	Silvery flower (tetraploid) 2	40.488
	CNS0095612	Silvery flower (tetraploid) 3	29.736
	CNS0095613	Golden flower (tetraploid) 1	29.886
	CNS0095614	Golden flower (tetraploid) 2	33.133
	CNS0095615	Golden flower (tetraploid) 3	15.422
CRA001975	CRR073297	Stem 1	10.169
	CRR073298	Stem 2	13.575
	CRR073299	Stem 3	9.069
	CRR073300	Leaf 1	13.389
	CRR073301	Leaf 2	15.210
	CRR073302	Leaf 3	9.858
	CRR073303	Juvenile bud 1	8.822
	CRR073304	Juvenile bud 2	6.268
	CRR073305	Juvenile bud 3	5.998
	CRR073306	Third green 1	0.592
	CRR073307	Third green 2	0.160
	CRR073308	Third green 3	1.301
	CRR073309	Second white 1	5.665
	CRR073310	Second white 2	5.867
	CRR073311	Second white 3	4.965
	CRR073312	Silver flowering 1	2.858
	CRR073313	Silver flowering 2	4.857
	CRR073314	Silver flowering 3	0.956
	CRR073315	Gold flowering 1	15.674
	CRR073316	Gold flowering 2	14.069
	CRR073317	Gold flowering 3	11.852
	CRR073318	Tawny withering 1	18.923
	CRR073319	Tawny withering 2	18.824
	CRR073320	Tawny withering 3	11.259