Gene detail

Detail information of GWHGAAZE031710

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009611356.1	1.87086E-74	PREDICTED: polyamine oxidase 1 isoform X2 [Nicotiana tomentosiformis]
COG	YP_006874256.1	9E-16	amine oxidase
Swissprot	tr\|Q9FNA2\|PAO1_ARATH	1E-56	Polyamine oxidase 1
trEMBL	tr\|Q4H439\|Q4H439_TOBAC	2E-74	Polyamine oxidase {ECO:0000313\|EMBL:BAE16174.1}
TAIR10	AT5G13700.1	4E-48	polyamine oxidase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	63904825	63905910	+
GWHAAZE00000009	mRNA	63904825	63905910	+
GWHAAZE00000009	exon	63904825	63904876	+
GWHAAZE00000009	exon	63905175	63905424	+
GWHAAZE00000009	exon	63905778	63905910	+
GWHAAZE00000009	CDS	63904825	63904876	+
GWHAAZE00000009	CDS	63905175	63905424	+
GWHAAZE00000009	CDS	63905778	63905910	+

Transcript Sequence
>GWHTAAZE031748 ATGGAATCTCCGACGCGTTGTTCGGTTATCATCGTAGGAGCAGGTGTTTCAGGTATATCGGCGGCGAAGGTATTGGCGGAGAATGGGGTAGAGGATATGGTGATATTGGAGGCGTCGGATAGAATAGGAGGGAGGATAAGGAAGGATGATTTCGGAGGGGTGTCGGTGGAGCTAGGGGCGGGTTGGATAGCTGGAGTTGGTGGCAAAGAGTCCAATCCCGTTTGGGAACTTGCTCGCCAATCGGGCCTCCGCACATGTTTCTCCGACTACAGCAATGCTCGTTACAACATTTACGATCCAAGCGGGAAGATATTTCCGAGTGGAATAGCTGCAGACTCATATAAGAAGGCGGTGGACTCGGCGATTGAGAAGCTAAGAACTGACGAGGCCAACCATGGCGATGACGTGGCCAATCTTTACGAACCCCCATCGTAA

Network for GWHGAAZE031710

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01593.25	Amino_oxidase	16	112	6.70E-20

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13366	MPAO, PAO1	Metabolic pathways	map01100
		Arginine and proline metabolism	map00330
		beta-Alanine metabolism	map00410

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	5.918
	SRR3591706	second leaf	1.941
	SRR3591707	mature leaf	2.115
	SRR3591708	Shoot apex	2.146
	SRR3591709	Stem	2.229
	SRR3591710	White floral bud	10.852
	SRR3591711	White flower	4.262
	SRR3591712	Green floral bud	18.042
	SRR3591713	Yellow flower	2.280
SRP173429	SRR8316895	Juvenile bud stage	4.314
	SRR8316896	Juvenile bud stage	18.254
	SRR8316897	Juvenile bud stage	6.105
	SRR8316894	Third green stage	6.533
	SRR8316900	Third green stage	15.026
	SRR8316901	Third green stage	14.080
	SRR8316898	Complete white stage	5.246
	SRR8316899	Complete white stage	7.373
	SRR8316903	Complete white stage	6.777
	SRR8316902	Silver flowering stage	6.545
	SRR8316904	Silver flowering stage	8.505
	SRR8316905	Silver flowering stage	4.049
	SRR8316906	Gold flowering stage	6.437
	SRR8316907	Gold flowering stage	12.525
	SRR8316908	Gold flowering stage	6.423
SRP132670	SRR6706286	Control	35.701
	SRR6706287	Light intensity 50%	33.030
	SRR6706288	Light intensity 20%	33.109
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.829
	CNS0095593	Slightly white alabastrum(diploid) 2	5.077
	CNS0095594	Slightly white alabastrum(diploid) 3	11.465
	CNS0095595	Whole white alabastrum(diploid) 2	10.590
	CNS0095596	Whole white alabastrum(diploid) 3	6.218
	CNS0095597	Whole white alabastrum(diploid) 4	13.227
	CNS0095598	Silvery flower (diploied) 1	4.050
	CNS0095599	Silvery flower (diploied) 2	6.891
	CNS0095600	Silvery flower (diploied) 3	24.097
	CNS0095601	Golden flower (diploid) 1	1.025
	CNS0095602	Golden flower (diploid) 2	10.617
	CNS0095603	Golden flower (diploid) 3	14.684
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.118
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.295
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.975
	CNS0095607	Whole white alabastrum(tetraploid) 1	14.391
	CNS0095608	Whole white alabastrum(tetraploid) 2	15.788
	CNS0095609	Whole white alabastrum(tetraploid) 3	31.746
	CNS0095610	Silvery flower (tetraploid) 1	14.796
	CNS0095611	Silvery flower (tetraploid) 2	12.739
	CNS0095612	Silvery flower (tetraploid) 3	19.659
	CNS0095613	Golden flower (tetraploid) 1	28.309
	CNS0095614	Golden flower (tetraploid) 2	11.168
	CNS0095615	Golden flower (tetraploid) 3	5.164
CRA001975	CRR073297	Stem 1	5.813
	CRR073298	Stem 2	8.072
	CRR073299	Stem 3	6.605
	CRR073300	Leaf 1	4.441
	CRR073301	Leaf 2	2.864
	CRR073302	Leaf 3	5.426
	CRR073303	Juvenile bud 1	2.942
	CRR073304	Juvenile bud 2	5.276
	CRR073305	Juvenile bud 3	3.069
	CRR073306	Third green 1	17.986
	CRR073307	Third green 2	15.065
	CRR073308	Third green 3	14.330
	CRR073309	Second white 1	13.642
	CRR073310	Second white 2	13.240
	CRR073311	Second white 3	16.522
	CRR073312	Silver flowering 1	35.773
	CRR073313	Silver flowering 2	27.159
	CRR073314	Silver flowering 3	32.616
	CRR073315	Gold flowering 1	2.169
	CRR073316	Gold flowering 2	6.273
	CRR073317	Gold flowering 3	2.229
	CRR073318	Tawny withering 1	2.996
	CRR073319	Tawny withering 2	12.228
	CRR073320	Tawny withering 3	5.550