Gene detail

Detail information of GWHGAAZE031725

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007029244.1	1.14859E-52	Glutamine-fructose-6-phosphate transaminase (isomerizing)s,sugar binding,transaminases isoform 2 [Theobroma cacao]
COG	YP_006432345.1	2E-31	glucosamine--fructose-6-phosphate aminotransferase
Swissprot	tr\|O19908\|GLMS_CYACA	4E-20	Glutamine--fructose-6-phosphate aminotransferase [isomerizing] {ECO:0000255\|HAMAP-Rule:MF_00164}
trEMBL	tr\|A0A061EY89\|A0A061EY89_THECC	4E-53	Glutamine-fructose-6-phosphate transaminase (Isomerizing)s,sugar binding,transaminases isoform 2 {ECO:0000313\|EMBL:EOY09746.1}
TAIR10	AT3G24090.1	2E-44	glutamine-fructose-6-phosphate transaminase (isomerizing)s;sugar binding;transaminases

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	64080635	64082971	-
GWHAAZE00000009	mRNA	64080635	64082971	-
GWHAAZE00000009	exon	64082751	64082971	-
GWHAAZE00000009	exon	64081885	64081925	-
GWHAAZE00000009	exon	64080635	64080750	-
GWHAAZE00000009	CDS	64082751	64082971	-
GWHAAZE00000009	CDS	64081885	64081925	-
GWHAAZE00000009	CDS	64080635	64080750	-

Transcript Sequence
>GWHTAAZE031763 ATGAAGGATCTTGCAAAATCACTTATTGCTGAGCAGTCACTTCTTTTGTTTGGAAGAGGATACAACTATGCTACTGCTTTAGAGGGTGCCTTGAAGGTGAAGGAGTTGGCCCTTATGCACAGTGAAGGGATACTTGCTGGTGAAATGAAACACGGTCCTTTGGCTTTAGTTGATGAAAATCTCCCAATTGTTGTTATTGCAACCCGGGATGCTTGCTTTAGAGGACTGTCTGCAGCCTGTCATCAACATAGTTCCTTTGCAGGTTATTTTTCATTTGTACCATCTTTTGTGCAGTTATTGGCCTATCATCTAACTGTTCTAAGGGGTTACAATGTTGACCAGCCTCAAAATCTTGCAAAGAGTGTCACTACTGAATGA

Network for GWHGAAZE031725

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01380.23	SIS	8	70	2.00E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00820	glmS, GFPT	Metabolic pathways	map01100
		Amino sugar and nucleotide sugar metabolism	map00520
		Alanine, aspartate and glutamate metabolism	map00250

Gene Ontology

GO term	Ontology	Name
GO:1901135	biological_process	carbohydrate derivative metabolic process
GO:0097367	molecular_function	carbohydrate derivative binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.157
	SRR3591706	second leaf	1.966
	SRR3591707	mature leaf	1.474
	SRR3591708	Shoot apex	2.768
	SRR3591709	Stem	1.294
	SRR3591710	White floral bud	1.524
	SRR3591711	White flower	1.964
	SRR3591712	Green floral bud	1.983
	SRR3591713	Yellow flower	1.224
SRP173429	SRR8316895	Juvenile bud stage	1.580
	SRR8316896	Juvenile bud stage	2.442
	SRR8316897	Juvenile bud stage	1.939
	SRR8316894	Third green stage	1.148
	SRR8316900	Third green stage	1.194
	SRR8316901	Third green stage	2.356
	SRR8316898	Complete white stage	0.147
	SRR8316899	Complete white stage	0.815
	SRR8316903	Complete white stage	0.127
	SRR8316902	Silver flowering stage	0.530
	SRR8316904	Silver flowering stage	0.138
	SRR8316905	Silver flowering stage	0.155
	SRR8316906	Gold flowering stage	0.175
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.222
SRP132670	SRR6706286	Control	1.053
	SRR6706287	Light intensity 50%	0.956
	SRR6706288	Light intensity 20%	0.824
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.317
	CNS0095593	Slightly white alabastrum(diploid) 2	3.243
	CNS0095594	Slightly white alabastrum(diploid) 3	2.393
	CNS0095595	Whole white alabastrum(diploid) 2	2.362
	CNS0095596	Whole white alabastrum(diploid) 3	3.320
	CNS0095597	Whole white alabastrum(diploid) 4	1.934
	CNS0095598	Silvery flower (diploied) 1	1.353
	CNS0095599	Silvery flower (diploied) 2	2.030
	CNS0095600	Silvery flower (diploied) 3	0.500
	CNS0095601	Golden flower (diploid) 1	1.682
	CNS0095602	Golden flower (diploid) 2	0.579
	CNS0095603	Golden flower (diploid) 3	0.705
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.043
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.593
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.188
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.193
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.908
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.046
	CNS0095610	Silvery flower (tetraploid) 1	0.130
	CNS0095611	Silvery flower (tetraploid) 2	0.769
	CNS0095612	Silvery flower (tetraploid) 3	0.576
	CNS0095613	Golden flower (tetraploid) 1	0.328
	CNS0095614	Golden flower (tetraploid) 2	0.208
	CNS0095615	Golden flower (tetraploid) 3	0.333
CRA001975	CRR073297	Stem 1	2.601
	CRR073298	Stem 2	2.540
	CRR073299	Stem 3	0.496
	CRR073300	Leaf 1	1.425
	CRR073301	Leaf 2	1.746
	CRR073302	Leaf 3	0.532
	CRR073303	Juvenile bud 1	0.961
	CRR073304	Juvenile bud 2	0.358
	CRR073305	Juvenile bud 3	0.206
	CRR073306	Third green 1	0.078
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	1.964
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.204
	CRR073319	Tawny withering 2	0.748
	CRR073320	Tawny withering 3	0.000