Gene detail

Detail information of GWHGAAZE031760

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007204885.1	1.0165E-27	hypothetical protein PRUPE_ppa017803mg [Prunus persica]
Swissprot	tr\|Q5W9E7\|MUS81_ARATH	2E-24	Crossover junction endonuclease MUS81
trEMBL	tr\|M5VXE5\|M5VXE5_PRUPE	4E-28	Uncharacterized protein {ECO:0000313\|EMBL:EMJ06084.1}
TAIR10	AT4G30870.1	8E-22	Restriction endonuclease, type II-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	64564171	64564945	+
GWHAAZE00000009	mRNA	64564171	64564945	+
GWHAAZE00000009	exon	64564171	64564292	+
GWHAAZE00000009	exon	64564368	64564421	+
GWHAAZE00000009	exon	64564708	64564945	+
GWHAAZE00000009	CDS	64564171	64564292	+
GWHAAZE00000009	CDS	64564368	64564421	+
GWHAAZE00000009	CDS	64564708	64564945	+

Transcript Sequence
>GWHTAAZE031798 ATGTTGACCCCCCTTTTTGTAGCAAATTCAGATTTCAAGAATATATCCGTGGATGGAAGGAATGGGGCTATAGCATTAAGCAAGCGAAACTCCATAGTTTCTCCATCAATGGATGGCCGAAATTCTGATATCTTTTCTTGTGTCGTACTGTCATCTATTCATATAGTTACTTTTCTTCCTTGTACACTTCATATTTACACATTGACCGTCTTACAGGTTAGACGGTTACCTATTGGAGATGGCATCTGGATCGCTCGCCATAAACATTTTGGCAGTGAATATGTTCTCGATTTTATAGTTGAGAGGAAGAAAATTGATGATTTACGGAGCTCAATTAGGGATAATCGCTATAGAGATCAGAAAGTTCGGCTTCTGGTATCACTTCTTACTGGTTTCCTAACTATTCCACTTTGA

Network for GWHGAAZE031760

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02732.16	ERCC4	71	124	2.30E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08991	MUS81	Homologous recombination	map03440
K08991	MUS81	Fanconi anemia pathway	map03460

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding
GO:0004518	molecular_function	nuclease activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.450
	SRR3591706	second leaf	0.207
	SRR3591707	mature leaf	0.487
	SRR3591708	Shoot apex	2.216
	SRR3591709	Stem	1.182
	SRR3591710	White floral bud	0.144
	SRR3591711	White flower	0.866
	SRR3591712	Green floral bud	0.649
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.189
	SRR8316896	Juvenile bud stage	0.799
	SRR8316897	Juvenile bud stage	0.143
	SRR8316894	Third green stage	0.299
	SRR8316900	Third green stage	0.590
	SRR8316901	Third green stage	0.476
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.875
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.073
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.185
	SRR8316907	Gold flowering stage	0.393
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.428
	SRR6706287	Light intensity 50%	0.703
	SRR6706288	Light intensity 20%	0.677
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.423
	CNS0095593	Slightly white alabastrum(diploid) 2	0.159
	CNS0095594	Slightly white alabastrum(diploid) 3	0.257
	CNS0095595	Whole white alabastrum(diploid) 2	0.860
	CNS0095596	Whole white alabastrum(diploid) 3	1.907
	CNS0095597	Whole white alabastrum(diploid) 4	1.078
	CNS0095598	Silvery flower (diploied) 1	0.214
	CNS0095599	Silvery flower (diploied) 2	0.052
	CNS0095600	Silvery flower (diploied) 3	0.069
	CNS0095601	Golden flower (diploid) 1	0.254
	CNS0095602	Golden flower (diploid) 2	0.210
	CNS0095603	Golden flower (diploid) 3	0.170
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.913
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.398
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.756
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.427
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.646
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.624
	CNS0095610	Silvery flower (tetraploid) 1	0.771
	CNS0095611	Silvery flower (tetraploid) 2	0.341
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.120
	CNS0095614	Golden flower (tetraploid) 2	0.159
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.315
	CRR073298	Stem 2	0.327
	CRR073299	Stem 3	0.599
	CRR073300	Leaf 1	0.377
	CRR073301	Leaf 2	0.141
	CRR073302	Leaf 3	0.421
	CRR073303	Juvenile bud 1	1.014
	CRR073304	Juvenile bud 2	0.203
	CRR073305	Juvenile bud 3	0.424
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.019
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.155
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.038
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.116
	CRR073318	Tawny withering 1	0.047
	CRR073319	Tawny withering 2	0.372
	CRR073320	Tawny withering 3	0.349