Gene detail

Detail information of GWHGAAZE031787

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP35769.1	4.11112E-89	hypothetical protein JCGZ_10726 [Jatropha curcas]
Swissprot	tr\|O22203\|C98A3_ARATH	1E-82	Cytochrome P450 98A3
trEMBL	tr\|A0A067KVB4\|A0A067KVB4_JATCU	2E-89	Uncharacterized protein {ECO:0000313\|EMBL:KDP35769.1}
TAIR10	AT2G40890.1	4E-69	cytochrome P450, family 98, subfamily A, polypeptide 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	64853230	64855550	+
GWHAAZE00000009	mRNA	64853230	64855550	+
GWHAAZE00000009	exon	64853230	64853515	+
GWHAAZE00000009	exon	64855128	64855550	+
GWHAAZE00000009	CDS	64853230	64853515	+
GWHAAZE00000009	CDS	64855128	64855390	+
GWHAAZE00000009	three_prime_UTR	64855391	64855550	+

Transcript Sequence
>GWHTAAZE031825 TGGGCCCAATCCTACGGTCCGATCATCTCAGTCTGGTTTGGCTCCACCCTAAACGTCATCGTTTCAAACACGGAGTTGGCCAAAGAAGTCCTTAAAGAAAAGGAGCCGTTTAGCCGAGATGGGCAGGATTTAATATGGGCCGATTATGGGCCCCACTATGTGAAAGTGAGGAAAGTGTGTACACTTGAGCTTTTTACTCCAAAGAGGCTTGAGGCTCTTAGGCCCATTAGAGAAGATGAGGTCACTGCCATGGTGGAATCTATTTATAATGATTGCACCAATCCTGATATGAGAGGCAAGAGTTTGTTAGTGAAGAAGTACCTAGGAGCGGTAGCATTCAACAACATCACAAGGCTTGCTTTCGGAAAGCGGTTTATGAACTCCGAGGGTGTGATCGATGAGCAAGGCCAGGAGTTCAAGGCCGTTGTGGCTAATGGGCTTAAGCTCGGGCTTCTCTTGCAATGGCAGAGCACATTCCATGGCTACGTTGGTTCTTTCCTCTTGAGGAAGAAGCATTTGCAAAGCACGGGGCTCGTCGTGACCGTCTGACCCGTGCCATCATGGAGGAGCACACCCTTGCCCGCCAAAAGAGCGGTGGAGCTAAGCAACATTTTGTTGATGCGTTGCTCACTCTTAAAGATCAATATGACCTTAGTGAGGATACCATTATTGGCTTGCTTTGGGTAAGTTGATTGATTACTCTTATCAA

Network for GWHGAAZE031787

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	2	130	1.40E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K09754	CYP98A, C3'H	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Phenylpropanoid biosynthesis	map00940
		Stilbenoid, diarylheptanoid and gingerol biosynthesis	map00945
		Flavonoid biosynthesis	map00941

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	77.284
	SRR3591706	second leaf	14.519
	SRR3591707	mature leaf	4.249
	SRR3591708	Shoot apex	15.231
	SRR3591709	Stem	423.234
	SRR3591710	White floral bud	18.145
	SRR3591711	White flower	22.726
	SRR3591712	Green floral bud	11.803
	SRR3591713	Yellow flower	28.385
SRP173429	SRR8316895	Juvenile bud stage	30.625
	SRR8316896	Juvenile bud stage	17.569
	SRR8316897	Juvenile bud stage	5.375
	SRR8316894	Third green stage	4.200
	SRR8316900	Third green stage	10.333
	SRR8316901	Third green stage	12.417
	SRR8316898	Complete white stage	7.578
	SRR8316899	Complete white stage	12.986
	SRR8316903	Complete white stage	16.043
	SRR8316902	Silver flowering stage	6.367
	SRR8316904	Silver flowering stage	5.950
	SRR8316905	Silver flowering stage	2.507
	SRR8316906	Gold flowering stage	12.857
	SRR8316907	Gold flowering stage	12.760
	SRR8316908	Gold flowering stage	22.505
SRP132670	SRR6706286	Control	10.211
	SRR6706287	Light intensity 50%	6.993
	SRR6706288	Light intensity 20%	6.463
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.840
	CNS0095593	Slightly white alabastrum(diploid) 2	5.340
	CNS0095594	Slightly white alabastrum(diploid) 3	6.977
	CNS0095595	Whole white alabastrum(diploid) 2	3.383
	CNS0095596	Whole white alabastrum(diploid) 3	2.781
	CNS0095597	Whole white alabastrum(diploid) 4	2.658
	CNS0095598	Silvery flower (diploied) 1	3.334
	CNS0095599	Silvery flower (diploied) 2	1.093
	CNS0095600	Silvery flower (diploied) 3	8.394
	CNS0095601	Golden flower (diploid) 1	2.951
	CNS0095602	Golden flower (diploid) 2	9.402
	CNS0095603	Golden flower (diploid) 3	10.701
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.543
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.433
	CNS0095606	Slightly white alabastrum(tetraploid) 3	19.798
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.269
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.764
	CNS0095609	Whole white alabastrum(tetraploid) 3	10.141
	CNS0095610	Silvery flower (tetraploid) 1	21.504
	CNS0095611	Silvery flower (tetraploid) 2	14.032
	CNS0095612	Silvery flower (tetraploid) 3	13.937
	CNS0095613	Golden flower (tetraploid) 1	12.478
	CNS0095614	Golden flower (tetraploid) 2	20.712
	CNS0095615	Golden flower (tetraploid) 3	14.147
CRA001975	CRR073297	Stem 1	40.321
	CRR073298	Stem 2	25.186
	CRR073299	Stem 3	19.276
	CRR073300	Leaf 1	10.747
	CRR073301	Leaf 2	8.636
	CRR073302	Leaf 3	10.695
	CRR073303	Juvenile bud 1	7.948
	CRR073304	Juvenile bud 2	4.587
	CRR073305	Juvenile bud 3	19.661
	CRR073306	Third green 1	19.135
	CRR073307	Third green 2	16.752
	CRR073308	Third green 3	15.040
	CRR073309	Second white 1	12.099
	CRR073310	Second white 2	6.220
	CRR073311	Second white 3	14.777
	CRR073312	Silver flowering 1	28.314
	CRR073313	Silver flowering 2	39.608
	CRR073314	Silver flowering 3	30.776
	CRR073315	Gold flowering 1	1.451
	CRR073316	Gold flowering 2	1.931
	CRR073317	Gold flowering 3	2.581
	CRR073318	Tawny withering 1	84.651
	CRR073319	Tawny withering 2	44.073
	CRR073320	Tawny withering 3	143.309