Gene detail

Detail information of GWHGAAZE031801

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002525570.1	4.2568E-65	conserved hypothetical protein [Ricinus communis]
trEMBL	tr\|B9SHV1\|B9SHV1_RICCO	2E-65	Putative uncharacterized protein {ECO:0000313\|EMBL:EEF36829.1}
TAIR10	AT5G07900.1	5E-33	Mitochondrial transcription termination factor family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	65070004	65070714	-
GWHAAZE00000009	mRNA	65070004	65070714	-
GWHAAZE00000009	exon	65070004	65070714	-
GWHAAZE00000009	CDS	65070004	65070714	-

Transcript Sequence
>GWHTAAZE031839 ATGAAAATCCTTAGGAAATACGTGAAGACGAATGAGAAAGTTGTTGCTGCTGTTAAACACTGGACGTGCCTTTCGTCGTGTGATATGAAGGGAATTCTGCAACCGAATGTCGAGTTCTTGTTAAGTGAAGGGGTGCCCCCTACCACTATAGAAAACCTGATTGTGTGGCATTCCAGAACTTTAATTGTGAAGTTAGATAAATTCGTTACCATAGTTGAAATTCTCAAGAAATTGGGTTTTAAGCCTACTTCTACGACGTTTATAGTAGCTCTTCGATGTTTGGTCTCAGTGAGTAATTCAACATCAGAAAGGAAAGTGCAGTTGTTTAAGAGTTGGGGATGGTCTGAGGAACAGATTGTATCTGCGTTTAAGCGTGATCCACTTAGTTTAGCTGGTTCTGAGGAGAAAATTAGGAGTATAATGGATTTTTATGTGAACACAATGAAATTGAATCCAGCGGATATAGCCGCTTATCCCACAGTACTTAGGTTCAGCCTAAATACTAGAACTCGGCCGAGGTATAATGTTATAAAGGTTTTGGAGTCCAAAAATTTGATTAAGAAGCCCAAGAAGCTTGTCTGGATATCTGCACTAACTGAAAAGGAATTCTTAAAACGCTTTGTGGATAAGCATTTGGACCAAGTCCCAAATTTAATGGAGATATATCGGGGTACTATCACAGGTGATAAGATTGATATTAAGCTACACTGA

Network for GWHGAAZE031801

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02536.15	mTERF	94	203	4.70E-17

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	mTERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003690	molecular_function	double-stranded DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	7.159
	SRR3591706	second leaf	6.400
	SRR3591707	mature leaf	9.651
	SRR3591708	Shoot apex	8.511
	SRR3591709	Stem	6.018
	SRR3591710	White floral bud	7.846
	SRR3591711	White flower	10.127
	SRR3591712	Green floral bud	7.294
	SRR3591713	Yellow flower	3.856
SRP173429	SRR8316895	Juvenile bud stage	6.414
	SRR8316896	Juvenile bud stage	9.472
	SRR8316897	Juvenile bud stage	6.127
	SRR8316894	Third green stage	3.970
	SRR8316900	Third green stage	10.442
	SRR8316901	Third green stage	12.669
	SRR8316898	Complete white stage	5.149
	SRR8316899	Complete white stage	13.034
	SRR8316903	Complete white stage	7.017
	SRR8316902	Silver flowering stage	4.682
	SRR8316904	Silver flowering stage	7.222
	SRR8316905	Silver flowering stage	4.645
	SRR8316906	Gold flowering stage	9.631
	SRR8316907	Gold flowering stage	6.705
	SRR8316908	Gold flowering stage	5.834
SRP132670	SRR6706286	Control	3.127
	SRR6706287	Light intensity 50%	2.845
	SRR6706288	Light intensity 20%	3.908
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	9.353
	CNS0095593	Slightly white alabastrum(diploid) 2	7.428
	CNS0095594	Slightly white alabastrum(diploid) 3	7.938
	CNS0095595	Whole white alabastrum(diploid) 2	8.400
	CNS0095596	Whole white alabastrum(diploid) 3	5.438
	CNS0095597	Whole white alabastrum(diploid) 4	7.190
	CNS0095598	Silvery flower (diploied) 1	14.728
	CNS0095599	Silvery flower (diploied) 2	16.769
	CNS0095600	Silvery flower (diploied) 3	20.114
	CNS0095601	Golden flower (diploid) 1	17.576
	CNS0095602	Golden flower (diploid) 2	15.378
	CNS0095603	Golden flower (diploid) 3	17.390
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.261
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.002
	CNS0095606	Slightly white alabastrum(tetraploid) 3	12.814
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.771
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.338
	CNS0095609	Whole white alabastrum(tetraploid) 3	10.016
	CNS0095610	Silvery flower (tetraploid) 1	21.962
	CNS0095611	Silvery flower (tetraploid) 2	25.365
	CNS0095612	Silvery flower (tetraploid) 3	14.623
	CNS0095613	Golden flower (tetraploid) 1	16.892
	CNS0095614	Golden flower (tetraploid) 2	19.367
	CNS0095615	Golden flower (tetraploid) 3	9.462
CRA001975	CRR073297	Stem 1	2.848
	CRR073298	Stem 2	2.951
	CRR073299	Stem 3	2.213
	CRR073300	Leaf 1	2.170
	CRR073301	Leaf 2	3.561
	CRR073302	Leaf 3	2.434
	CRR073303	Juvenile bud 1	2.463
	CRR073304	Juvenile bud 2	3.435
	CRR073305	Juvenile bud 3	2.705
	CRR073306	Third green 1	2.534
	CRR073307	Third green 2	2.524
	CRR073308	Third green 3	2.326
	CRR073309	Second white 1	4.635
	CRR073310	Second white 2	2.943
	CRR073311	Second white 3	1.864
	CRR073312	Silver flowering 1	3.837
	CRR073313	Silver flowering 2	0.905
	CRR073314	Silver flowering 3	0.960
	CRR073315	Gold flowering 1	11.001
	CRR073316	Gold flowering 2	19.831
	CRR073317	Gold flowering 3	9.020
	CRR073318	Tawny withering 1	3.313
	CRR073319	Tawny withering 2	4.039
	CRR073320	Tawny withering 3	4.150