Gene detail

Detail information of GWHGAAZE031804

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP40593.1	6.95573E-92	hypothetical protein JCGZ_24592 [Jatropha curcas]
trEMBL	tr\|A0A067L028\|A0A067L028_JATCU	3E-92	Uncharacterized protein {ECO:0000313\|EMBL:KDP40593.1}
TAIR10	AT5G07900.1	6E-43	Mitochondrial transcription termination factor family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	65095080	65096102	+
GWHAAZE00000009	mRNA	65095080	65096102	+
GWHAAZE00000009	exon	65095080	65096102	+
GWHAAZE00000009	CDS	65095080	65096102	+

Transcript Sequence
>GWHTAAZE031842 GAAGCCCTAATTTCTGCATCCCAGGAGTTGTTCCAATTATTAGAGGAATTGAAGTCACGTAAACATCAATCTGAAATCTTATCCCTTTTAACATCCTTTCATTTCTCCGATACCCAAATCAAGAAACTTCTCATTAAGTACCCCAAGATCCTCCAATACAATGTAAACAATTTTCTTAAACCTAAATTACAGTTCCTCACAGATTATGGCTTTGCCGGTCCCCTCCTCCCGAACCTAATTGCCGCGTATCCGAATATTTTGGAGAGAAGCTTGTTTGACTGCATCATACCAAGATTTGAATTCCTCAAGAAGTACCTACATACCAATGACAAACTTGTAGCTGCTCTTAAACGCTCGTCGAGGCTCATGACATGTGATTTGAAGGCAATTGTGCAACCAAATATCGACTTCTTGTTAAGTGAAGGGGCGAACCTTACCACCGTAGCCAAGGAGCTGCTTAAGCAGCCGAGAACTCTGATGATGAATCCTGATAAAATTGTGAAAGCAGTTGAAACTGTCAAACAATTGGGTCTCGACCCTAGTGCTCGTAAGTTTCTAGTAGCTGTACGGGTGATTCGCTCAATGAGCGATTCAACGTGGGATATGAAAGTGCAAATGTTTAAGAGTTTCGGGTGGTCTGAGGAAGAGATTACTTCTGCATTTAAGCGCTATCCGGCAGTTTTCGCTTGTTCTGAGGAGAAGATCAGGACTTTAATGGATTTTTACTTGAACACTGTGAATTTGAATCCTGATGTTATTATAAGTTATCCCATGTTACTCAACTACGGGCTAAGTACAAGAATTCTTCCAAGGTATAATGTCATGAAAGTGTTGAAGTCCAAAGGATTGCTTGAAAAGGACAGGAAGCTTCGTTACTTGCTCAAACTAAGTGAGGAAAAATTCGTGACAAGTCTTGTGGATAAGCATTTGGATGAAGTTCCAAATCTGATGGAGCTATATTGTGGTAATATCAGCGTTGATGAGATCGATATTCAGCTACACTACACTGATGAAGTAAGTTAA

Network for GWHGAAZE031804

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02536.15	mTERF	27	179	1.30E-17
PF02536.15	mTERF	100	301	1.80E-25

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	mTERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003690	molecular_function	double-stranded DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	5.320
	SRR3591706	second leaf	4.581
	SRR3591707	mature leaf	8.864
	SRR3591708	Shoot apex	9.061
	SRR3591709	Stem	6.551
	SRR3591710	White floral bud	5.303
	SRR3591711	White flower	15.312
	SRR3591712	Green floral bud	9.485
	SRR3591713	Yellow flower	13.491
SRP173429	SRR8316895	Juvenile bud stage	9.317
	SRR8316896	Juvenile bud stage	8.886
	SRR8316897	Juvenile bud stage	5.146
	SRR8316894	Third green stage	5.165
	SRR8316900	Third green stage	18.554
	SRR8316901	Third green stage	11.965
	SRR8316898	Complete white stage	9.013
	SRR8316899	Complete white stage	16.798
	SRR8316903	Complete white stage	11.246
	SRR8316902	Silver flowering stage	9.131
	SRR8316904	Silver flowering stage	13.145
	SRR8316905	Silver flowering stage	7.312
	SRR8316906	Gold flowering stage	16.791
	SRR8316907	Gold flowering stage	12.799
	SRR8316908	Gold flowering stage	15.469
SRP132670	SRR6706286	Control	12.502
	SRR6706287	Light intensity 50%	13.653
	SRR6706288	Light intensity 20%	14.584
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.199
	CNS0095593	Slightly white alabastrum(diploid) 2	9.443
	CNS0095594	Slightly white alabastrum(diploid) 3	5.870
	CNS0095595	Whole white alabastrum(diploid) 2	7.320
	CNS0095596	Whole white alabastrum(diploid) 3	6.908
	CNS0095597	Whole white alabastrum(diploid) 4	6.915
	CNS0095598	Silvery flower (diploied) 1	13.162
	CNS0095599	Silvery flower (diploied) 2	11.954
	CNS0095600	Silvery flower (diploied) 3	22.866
	CNS0095601	Golden flower (diploid) 1	11.348
	CNS0095602	Golden flower (diploid) 2	20.867
	CNS0095603	Golden flower (diploid) 3	18.984
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.125
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.158
	CNS0095606	Slightly white alabastrum(tetraploid) 3	14.689
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.598
	CNS0095608	Whole white alabastrum(tetraploid) 2	8.168
	CNS0095609	Whole white alabastrum(tetraploid) 3	12.150
	CNS0095610	Silvery flower (tetraploid) 1	24.086
	CNS0095611	Silvery flower (tetraploid) 2	28.094
	CNS0095612	Silvery flower (tetraploid) 3	13.707
	CNS0095613	Golden flower (tetraploid) 1	16.745
	CNS0095614	Golden flower (tetraploid) 2	18.484
	CNS0095615	Golden flower (tetraploid) 3	15.187
CRA001975	CRR073297	Stem 1	8.269
	CRR073298	Stem 2	8.299
	CRR073299	Stem 3	8.506
	CRR073300	Leaf 1	10.314
	CRR073301	Leaf 2	8.725
	CRR073302	Leaf 3	8.657
	CRR073303	Juvenile bud 1	10.168
	CRR073304	Juvenile bud 2	7.000
	CRR073305	Juvenile bud 3	8.256
	CRR073306	Third green 1	5.185
	CRR073307	Third green 2	3.521
	CRR073308	Third green 3	5.283
	CRR073309	Second white 1	3.674
	CRR073310	Second white 2	3.719
	CRR073311	Second white 3	3.767
	CRR073312	Silver flowering 1	2.953
	CRR073313	Silver flowering 2	2.086
	CRR073314	Silver flowering 3	1.829
	CRR073315	Gold flowering 1	19.863
	CRR073316	Gold flowering 2	24.640
	CRR073317	Gold flowering 3	17.702
	CRR073318	Tawny withering 1	7.153
	CRR073319	Tawny withering 2	6.141
	CRR073320	Tawny withering 3	7.761