Gene detail

Detail information of GWHGAAZE031893

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006347753.1	1.91426E-75	PREDICTED: perakine reductase-like isoform X1 [Solanum tuberosum]
COG	NP_923784.1	1E-36	oxidoreductase
Swissprot	tr\|Q3L181\|PERR_RAUSE	2E-66	Perakine reductase
trEMBL	tr\|K4B0C6\|K4B0C6_SOLLC	3E-74	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc01g097390.2.1}
TAIR10	AT1G60750.1	3E-40	NAD(P)-linked oxidoreductase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	66738957	66740884	+
GWHAAZE00000009	mRNA	66738957	66740884	+
GWHAAZE00000009	exon	66738957	66739063	+
GWHAAZE00000009	exon	66739655	66739825	+
GWHAAZE00000009	exon	66740618	66740884	+
GWHAAZE00000009	five_prime_UTR	66738957	66739003	+
GWHAAZE00000009	CDS	66739004	66739063	+
GWHAAZE00000009	CDS	66739655	66739825	+
GWHAAZE00000009	CDS	66740618	66740884	+

Transcript Sequence
>GWHTAAZE031931 ATAATAATATAATAAATTAAATCAACTACAATTTTTCAATACAACAAATGGCTCAAGTGCACGACATTCATAATCCCAGAGTTAAACTTGGAAACCAGGGACTTGAGGTCTCAAAATTGGGATTTGGATGTATGGGTCTTAGTGGACACTACAATTCTCCAGTGGCAGAGGAGGATGGGATTCAAATAATCAAAGAATGCTTCAACAGAGGAATCACATTCTTGGATACTTCTGATATTTATGGTCTCAACCACGCCAATGAGATATTGGTTGGCAAGGCGCTGAAACATTTGCCTCGAGAAAAGATTCAGCTGGCCACAAAATTTGGGATTGCCAAACTGGAACCAACTAAAATGACAATCAAGGGTACCCCCGAATATGTCCGCTCTTGCTGCGAGGGTAGCCTAAAGCGCCTTGATGTGCATTACATTGATCTCTTCTATGTACATAGAATTGACACAACTGTACCTATCGAGGACACTGTAAGTATACTTATACACACACATATGGACCGTCTGTCGAAGGGCATCCTTATTTATAACTGA

Network for GWHGAAZE031893

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0246

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00248.22	Aldo_ket_red	23	149	1.70E-28

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.187
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.304
	SRR3591708	Shoot apex	1.205
	SRR3591709	Stem	0.690
	SRR3591710	White floral bud	1.571
	SRR3591711	White flower	3.741
	SRR3591712	Green floral bud	1.575
	SRR3591713	Yellow flower	3.414
SRP173429	SRR8316895	Juvenile bud stage	0.237
	SRR8316896	Juvenile bud stage	0.904
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.225
	SRR8316900	Third green stage	1.196
	SRR8316901	Third green stage	0.553
	SRR8316898	Complete white stage	0.849
	SRR8316899	Complete white stage	0.544
	SRR8316903	Complete white stage	2.171
	SRR8316902	Silver flowering stage	0.953
	SRR8316904	Silver flowering stage	2.100
	SRR8316905	Silver flowering stage	0.285
	SRR8316906	Gold flowering stage	5.597
	SRR8316907	Gold flowering stage	4.013
	SRR8316908	Gold flowering stage	5.188
SRP132670	SRR6706286	Control	2.132
	SRR6706287	Light intensity 50%	1.529
	SRR6706288	Light intensity 20%	1.543
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.988
	CNS0095593	Slightly white alabastrum(diploid) 2	12.309
	CNS0095594	Slightly white alabastrum(diploid) 3	12.510
	CNS0095595	Whole white alabastrum(diploid) 2	51.401
	CNS0095596	Whole white alabastrum(diploid) 3	0.223
	CNS0095597	Whole white alabastrum(diploid) 4	31.786
	CNS0095598	Silvery flower (diploied) 1	1.823
	CNS0095599	Silvery flower (diploied) 2	2.840
	CNS0095600	Silvery flower (diploied) 3	2.110
	CNS0095601	Golden flower (diploid) 1	0.565
	CNS0095602	Golden flower (diploid) 2	1.336
	CNS0095603	Golden flower (diploid) 3	1.919
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.497
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.918
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.650
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.454
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.100
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.606
	CNS0095610	Silvery flower (tetraploid) 1	7.485
	CNS0095611	Silvery flower (tetraploid) 2	1.078
	CNS0095612	Silvery flower (tetraploid) 3	2.319
	CNS0095613	Golden flower (tetraploid) 1	0.589
	CNS0095614	Golden flower (tetraploid) 2	3.950
	CNS0095615	Golden flower (tetraploid) 3	0.185
CRA001975	CRR073297	Stem 1	2.050
	CRR073298	Stem 2	1.002
	CRR073299	Stem 3	0.692
	CRR073300	Leaf 1	0.688
	CRR073301	Leaf 2	1.463
	CRR073302	Leaf 3	2.099
	CRR073303	Juvenile bud 1	0.297
	CRR073304	Juvenile bud 2	0.613
	CRR073305	Juvenile bud 3	0.614
	CRR073306	Third green 1	0.505
	CRR073307	Third green 2	0.812
	CRR073308	Third green 3	1.441
	CRR073309	Second white 1	0.552
	CRR073310	Second white 2	0.981
	CRR073311	Second white 3	0.215
	CRR073312	Silver flowering 1	0.495
	CRR073313	Silver flowering 2	0.218
	CRR073314	Silver flowering 3	0.107
	CRR073315	Gold flowering 1	0.081
	CRR073316	Gold flowering 2	1.078
	CRR073317	Gold flowering 3	0.557
	CRR073318	Tawny withering 1	6.604
	CRR073319	Tawny withering 2	10.446
	CRR073320	Tawny withering 3	1.206