Gene detail

Detail information of GWHGAAZE031894

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006577284.1	6.7225E-40	PREDICTED: probable aldo-keto reductase 1-like [Glycine max]
COG	NP_948362.1	2E-19	aldo/keto reductase
Swissprot	tr\|Q3L181\|PERR_RAUSE	3E-36	Perakine reductase
trEMBL	tr\|I1JRM5\|I1JRM5_SOYBN	3E-40	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA03G40680.1}
TAIR10	AT1G60730.3	2E-20	NAD(P)-linked oxidoreductase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	66742211	66742765	+
GWHAAZE00000009	mRNA	66742211	66742765	+
GWHAAZE00000009	exon	66742211	66742316	+
GWHAAZE00000009	exon	66742557	66742765	+
GWHAAZE00000009	CDS	66742211	66742316	+
GWHAAZE00000009	CDS	66742557	66742741	+
GWHAAZE00000009	three_prime_UTR	66742742	66742765	+

Transcript Sequence
>GWHTAAZE031932 ATGTTCAATCGAATAGAAGCATTGGCCGAGAAGCATGGATGTAGTACTGCTCAACTTGCTCTTGCTTGGGTTCTTCATCAAGGGGATGATGTTGTACCTATTCCTGGAACAACCAAGATTAAAAACCTCGATGAAAATTTTAGTGCATTGAGAGTCAAACTCGCCAAAGATGATATGAAAGAGATTTTAGATGCGGTTCCTATCAACGAGGTAGCAGGGACTAGAAATATTGAAGAATCTCTGCACGTATCTTGGAAGTTTGTGAATACGCCACTAAAACATGGCAAGTGATTTTCTTCACATAGAAACTGGAGA

Network for GWHGAAZE031894

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0246

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00248.22	Aldo_ket_red	3	62	5.10E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.888
	SRR3591706	second leaf	0.367
	SRR3591707	mature leaf	0.264
	SRR3591708	Shoot apex	2.417
	SRR3591709	Stem	0.303
	SRR3591710	White floral bud	2.356
	SRR3591711	White flower	4.880
	SRR3591712	Green floral bud	2.117
	SRR3591713	Yellow flower	4.651
SRP173429	SRR8316895	Juvenile bud stage	0.069
	SRR8316896	Juvenile bud stage	0.765
	SRR8316897	Juvenile bud stage	0.149
	SRR8316894	Third green stage	0.305
	SRR8316900	Third green stage	1.145
	SRR8316901	Third green stage	1.343
	SRR8316898	Complete white stage	1.754
	SRR8316899	Complete white stage	0.246
	SRR8316903	Complete white stage	0.422
	SRR8316902	Silver flowering stage	0.863
	SRR8316904	Silver flowering stage	2.116
	SRR8316905	Silver flowering stage	0.538
	SRR8316906	Gold flowering stage	1.300
	SRR8316907	Gold flowering stage	0.580
	SRR8316908	Gold flowering stage	2.316
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.017
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.680
	CNS0095593	Slightly white alabastrum(diploid) 2	18.290
	CNS0095594	Slightly white alabastrum(diploid) 3	24.206
	CNS0095595	Whole white alabastrum(diploid) 2	43.925
	CNS0095596	Whole white alabastrum(diploid) 3	0.937
	CNS0095597	Whole white alabastrum(diploid) 4	33.559
	CNS0095598	Silvery flower (diploied) 1	1.120
	CNS0095599	Silvery flower (diploied) 2	2.670
	CNS0095600	Silvery flower (diploied) 3	0.520
	CNS0095601	Golden flower (diploid) 1	0.357
	CNS0095602	Golden flower (diploid) 2	1.458
	CNS0095603	Golden flower (diploid) 3	0.599
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.595
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.269
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.843
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.244
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.142
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.248
	CNS0095610	Silvery flower (tetraploid) 1	4.386
	CNS0095611	Silvery flower (tetraploid) 2	0.576
	CNS0095612	Silvery flower (tetraploid) 3	0.955
	CNS0095613	Golden flower (tetraploid) 1	1.382
	CNS0095614	Golden flower (tetraploid) 2	0.940
	CNS0095615	Golden flower (tetraploid) 3	0.001
CRA001975	CRR073297	Stem 1	0.045
	CRR073298	Stem 2	0.114
	CRR073299	Stem 3	0.093
	CRR073300	Leaf 1	0.302
	CRR073301	Leaf 2	0.164
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.015
	CRR073306	Third green 1	0.074
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.116
	CRR073309	Second white 1	0.098
	CRR073310	Second white 2	0.740
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.321
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.032
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.220
	CRR073319	Tawny withering 2	2.429
	CRR073320	Tawny withering 3	0.293