Gene detail

Detail information of GWHGAAZE032016

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AJB84617.1	4.21506E-35	1-deoxy-D-xylulose-5-phosphate synthase [Camellia sinensis]
COG	YP_002289869.1	3E-21	1-deoxy-D-xylulose-5-phosphate synthase
Swissprot	tr\|Q6YU51\|DXS2_ORYSJ	1E-32	Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic (Precursor)
trEMBL	tr\|H6WAE3\|H6WAE3_9GENT	4E-35	Chloroplast 1-deoxy-D-xylulose 5-phosphate synthase 2 {ECO:0000313\|EMBL:AEZ55866.1}
TAIR10	AT4G15560.1	6E-27	Deoxyxylulose-5-phosphate synthase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	69018086	69019312	+
GWHAAZE00000009	mRNA	69018086	69019312	+
GWHAAZE00000009	exon	69018086	69018202	+
GWHAAZE00000009	exon	69018301	69018423	+
GWHAAZE00000009	exon	69019109	69019312	+
GWHAAZE00000009	CDS	69018086	69018202	+
GWHAAZE00000009	CDS	69018301	69018423	+
GWHAAZE00000009	CDS	69019109	69019312	+

Transcript Sequence
>GWHTAAZE032054 ATGCACGATGCGTTTGGCGTGGGTCATAGTCCAACTAGCATTTTAGCCGGGTTAGGGATGGTAGTCGAAAGAGACTTCTCGAGGAAGGAAGGGCAATCACGTGATCATTGTAAATTGGTTTTAGATTTTCCGTCGACTGCTATCGCTAATGGCCTTGCACAACCTGTTGGAGCTTTGAGCAAAGCTCTTACGAGGTTACAATCGAGTCAAAAGCTTCACCAGCATTGTGAAGTAATAAAAACCCACGAGATCGTGGTGAAAGTAGACACGTACATGAGAGGGATGACAGACGGTCAATGGGTTTCATTGTTTGAGGAGCTAGGGCTCTACTATATTGGTCCAGTTGATGGTCACAATGTTGAAAATCTTCTTTATATTTTGAACAAGGTTAAGGAAAATGGAATTGTCATGAAAGTGGAGCTATTTCATGTTTATCGCTTCTAA

Network for GWHGAAZE032016

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13292.7	DXP_synthase_N	52	144	8.00E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01662	dxs	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Thiamine metabolism	map00730
		Terpenoid backbone biosynthesis	map00900

Gene Ontology

GO term	Ontology	Name
GO:0016114	biological_process	terpenoid biosynthetic process
GO:0008661	molecular_function	1-deoxy-D-xylulose-5-phosphate synthase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.220
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.057
	SRR8316904	Silver flowering stage	0.324
	SRR8316905	Silver flowering stage	0.051
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.264
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.062
	CNS0095600	Silvery flower (diploied) 3	0.137
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	2.611
	CNS0095613	Golden flower (tetraploid) 1	0.179
	CNS0095614	Golden flower (tetraploid) 2	0.111
	CNS0095615	Golden flower (tetraploid) 3	0.160
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.009
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	1.815
	CRR073307	Third green 2	1.074
	CRR073308	Third green 3	1.112
	CRR073309	Second white 1	1.863
	CRR073310	Second white 2	2.143
	CRR073311	Second white 3	0.458
	CRR073312	Silver flowering 1	1.477
	CRR073313	Silver flowering 2	1.337
	CRR073314	Silver flowering 3	0.791
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000