Gene detail

Detail information of GWHGAAZE032130

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002523523.1	1.33112E-28	ribosomal protein L39e, putative [Ricinus communis]
COG	YP_006861875.1	0.0000008	50S ribosomal protein L39e
Swissprot	tr\|Q5SMI4\|RL393_ORYSJ	1E-28	60S ribosomal protein L39-3
trEMBL	tr\|B9SC04\|B9SC04_RICCO	5E-29	Ribosomal protein L39e, putative {ECO:0000313\|EMBL:EEF38862.1}
TAIR10	AT4G31985.1	1E-15	Ribosomal protein L39 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	71150237	71152308	-
GWHAAZE00000009	mRNA	71150237	71152308	-
GWHAAZE00000009	exon	71152261	71152308	-
GWHAAZE00000009	exon	71151018	71151121	-
GWHAAZE00000009	exon	71150237	71150487	-
GWHAAZE00000009	CDS	71152261	71152308	-
GWHAAZE00000009	CDS	71151018	71151121	-
GWHAAZE00000009	CDS	71150439	71150487	-
GWHAAZE00000009	three_prime_UTR	71150237	71150438	-

Transcript Sequence
>GWHTAAZE032168 ATGTGCACTTTGCACAATGTCAACCATCGGAAGAAGTTTGTCAATGTGCCGTCGCACAAGACCTTCATCATCAAGAAGAAGCTGGCTAAGAAGATGAGGCAGAATAGGCCTATTCCTCACTGGATTCGCATGAGGACTGACAACACTATCAGGTATAATGCAAAGCGTAGGCACTGGCGCCGCACCAAGCTTGGGTTTTGAGGTGTTTGAGTCCAACTGAGTACTTTTGTGAACTCTAAAATTGTCATTTTAGCAAGATTTTGTTGAGATTGTTACCTGAATTATTGTTTACATTTTGTGATTTTGGTTATGGATTTGACCTAATATTGTTTGTTTAGTGATTCAATGTGATTTTGCCATGGGTAAGGTATTGATGTTAATTTACTAGTTATATGCAATTTGG

Network for GWHGAAZE032130

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00832.21	Ribosomal_L39	24	64	1.80E-22

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02924	RP-L39e, RPL39	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	229.290
	SRR3591706	second leaf	105.261
	SRR3591707	mature leaf	48.041
	SRR3591708	Shoot apex	273.602
	SRR3591709	Stem	100.974
	SRR3591710	White floral bud	68.346
	SRR3591711	White flower	87.561
	SRR3591712	Green floral bud	153.155
	SRR3591713	Yellow flower	60.384
SRP173429	SRR8316895	Juvenile bud stage	55.653
	SRR8316896	Juvenile bud stage	68.633
	SRR8316897	Juvenile bud stage	36.770
	SRR8316894	Third green stage	26.661
	SRR8316900	Third green stage	117.061
	SRR8316901	Third green stage	112.635
	SRR8316898	Complete white stage	13.543
	SRR8316899	Complete white stage	68.929
	SRR8316903	Complete white stage	26.728
	SRR8316902	Silver flowering stage	20.355
	SRR8316904	Silver flowering stage	15.258
	SRR8316905	Silver flowering stage	8.477
	SRR8316906	Gold flowering stage	22.269
	SRR8316907	Gold flowering stage	30.519
	SRR8316908	Gold flowering stage	24.022
SRP132670	SRR6706286	Control	37.485
	SRR6706287	Light intensity 50%	27.529
	SRR6706288	Light intensity 20%	32.447
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	172.205
	CNS0095593	Slightly white alabastrum(diploid) 2	231.580
	CNS0095594	Slightly white alabastrum(diploid) 3	179.972
	CNS0095595	Whole white alabastrum(diploid) 2	175.243
	CNS0095596	Whole white alabastrum(diploid) 3	229.592
	CNS0095597	Whole white alabastrum(diploid) 4	137.885
	CNS0095598	Silvery flower (diploied) 1	67.422
	CNS0095599	Silvery flower (diploied) 2	63.654
	CNS0095600	Silvery flower (diploied) 3	44.392
	CNS0095601	Golden flower (diploid) 1	54.469
	CNS0095602	Golden flower (diploid) 2	37.358
	CNS0095603	Golden flower (diploid) 3	37.377
	CNS0095604	Slightly white alabastrum(tetraploid) 1	179.014
	CNS0095605	Slightly white alabastrum(tetraploid) 2	193.558
	CNS0095606	Slightly white alabastrum(tetraploid) 3	206.870
	CNS0095607	Whole white alabastrum(tetraploid) 1	128.477
	CNS0095608	Whole white alabastrum(tetraploid) 2	111.753
	CNS0095609	Whole white alabastrum(tetraploid) 3	168.706
	CNS0095610	Silvery flower (tetraploid) 1	58.848
	CNS0095611	Silvery flower (tetraploid) 2	45.838
	CNS0095612	Silvery flower (tetraploid) 3	46.048
	CNS0095613	Golden flower (tetraploid) 1	41.198
	CNS0095614	Golden flower (tetraploid) 2	43.207
	CNS0095615	Golden flower (tetraploid) 3	20.112
CRA001975	CRR073297	Stem 1	47.267
	CRR073298	Stem 2	53.427
	CRR073299	Stem 3	56.059
	CRR073300	Leaf 1	66.856
	CRR073301	Leaf 2	69.329
	CRR073302	Leaf 3	65.958
	CRR073303	Juvenile bud 1	70.238
	CRR073304	Juvenile bud 2	43.928
	CRR073305	Juvenile bud 3	40.634
	CRR073306	Third green 1	14.053
	CRR073307	Third green 2	22.654
	CRR073308	Third green 3	18.092
	CRR073309	Second white 1	20.272
	CRR073310	Second white 2	14.948
	CRR073311	Second white 3	3.615
	CRR073312	Silver flowering 1	9.661
	CRR073313	Silver flowering 2	19.421
	CRR073314	Silver flowering 3	10.858
	CRR073315	Gold flowering 1	44.773
	CRR073316	Gold flowering 2	37.230
	CRR073317	Gold flowering 3	35.501
	CRR073318	Tawny withering 1	67.705
	CRR073319	Tawny withering 2	62.472
	CRR073320	Tawny withering 3	71.276