Gene detail

Detail information of GWHGAAZE032150

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ACU18536.1	9.27703E-75	unknown [Glycine max]
COG	YP_007069323.1	1E-44	Delta-12 acyl-phospholipid desaturase
Swissprot	tr\|P48627\|FAD6C_BRANA	5E-72	Omega-6 fatty acid desaturase, chloroplastic (Precursor)
trEMBL	tr\|C6T9N4\|C6T9N4_SOYBN	3E-75	Putative uncharacterized protein {ECO:0000313\|EMBL:ACU18536.1}
TAIR10	AT4G30950.1	3E-60	fatty acid desaturase 6

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	71646932	71652525	+
GWHAAZE00000009	mRNA	71646932	71652525	+
GWHAAZE00000009	exon	71646932	71646961	+
GWHAAZE00000009	exon	71648349	71648492	+
GWHAAZE00000009	exon	71651311	71651429	+
GWHAAZE00000009	exon	71651910	71652024	+
GWHAAZE00000009	exon	71652376	71652525	+
GWHAAZE00000009	CDS	71646932	71646961	+
GWHAAZE00000009	CDS	71648349	71648492	+
GWHAAZE00000009	CDS	71651311	71651429	+
GWHAAZE00000009	CDS	71651910	71652024	+
GWHAAZE00000009	CDS	71652376	71652525	+

Transcript Sequence
>GWHTAAZE032188 ATGAGGATTCCTTTGCCGAACGCTGGTCTGGTGTTTGAGATTGATGATATGAAAGCATTGAAGTCAGGTTTTATATCTGTTACTTCATATGCATTGGGACTACTAATGATCTCCAAAGCACCATGGTATCTACTTCCTCTGGCTTGGGCATGGACTGGAACTGCAGTCACAGGGATGAGTACCTTCACAATGGTTCATCACACGGCGCCTCATATACCTTTTAAATCTTCAGAAGAGTGGAATGCAGCTCAGGCCAAACTTAACAGCACCGTTCACTGTGACTATCCGCGCTGGGTAGAGATTCTTTGTAATGATGTTAATGTCCATATCCCCCACCATATTTCTGTGAGGATACCAAGCTACAATTTGCGGGCCGCTGATCGGTCTTTTCAAGAAAATTGGGGAAAGTATCTGAATGAGGCAAATTGGAACTGGCGATTAATGAAGACGATATTGACAATCTGCCATATCTACGATAAAGATCAAAACTACATCGCATTTGACGGGCTTGCCCCCGAAGAATCACAACCGATTACGTTCCTTAAGAGTAATGCCTAG

Network for GWHGAAZE032150

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00487.25	FA_desaturase	24	137	7.40E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K10255	FAD6, desA	Two-component system	map02020

Gene Ontology

GO term	Ontology	Name
GO:0006629	biological_process	lipid metabolic process

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.421
	SRR3591706	second leaf	1.654
	SRR3591707	mature leaf	1.414
	SRR3591708	Shoot apex	5.431
	SRR3591709	Stem	1.822
	SRR3591710	White floral bud	1.254
	SRR3591711	White flower	1.238
	SRR3591712	Green floral bud	2.932
	SRR3591713	Yellow flower	0.052
SRP173429	SRR8316895	Juvenile bud stage	6.135
	SRR8316896	Juvenile bud stage	5.063
	SRR8316897	Juvenile bud stage	1.372
	SRR8316894	Third green stage	1.386
	SRR8316900	Third green stage	3.828
	SRR8316901	Third green stage	3.373
	SRR8316898	Complete white stage	0.202
	SRR8316899	Complete white stage	1.303
	SRR8316903	Complete white stage	0.594
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.135
	SRR8316905	Silver flowering stage	0.006
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.079
	SRR8316908	Gold flowering stage	0.150
SRP132670	SRR6706286	Control	2.667
	SRR6706287	Light intensity 50%	2.857
	SRR6706288	Light intensity 20%	4.149
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.118
	CNS0095593	Slightly white alabastrum(diploid) 2	5.332
	CNS0095594	Slightly white alabastrum(diploid) 3	7.287
	CNS0095595	Whole white alabastrum(diploid) 2	6.819
	CNS0095596	Whole white alabastrum(diploid) 3	3.844
	CNS0095597	Whole white alabastrum(diploid) 4	4.451
	CNS0095598	Silvery flower (diploied) 1	3.194
	CNS0095599	Silvery flower (diploied) 2	1.583
	CNS0095600	Silvery flower (diploied) 3	0.677
	CNS0095601	Golden flower (diploid) 1	1.998
	CNS0095602	Golden flower (diploid) 2	0.451
	CNS0095603	Golden flower (diploid) 3	0.306
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.747
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.217
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.382
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.100
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.988
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.467
	CNS0095610	Silvery flower (tetraploid) 1	0.383
	CNS0095611	Silvery flower (tetraploid) 2	0.651
	CNS0095612	Silvery flower (tetraploid) 3	0.912
	CNS0095613	Golden flower (tetraploid) 1	0.125
	CNS0095614	Golden flower (tetraploid) 2	0.588
	CNS0095615	Golden flower (tetraploid) 3	0.049
CRA001975	CRR073297	Stem 1	5.242
	CRR073298	Stem 2	3.478
	CRR073299	Stem 3	1.758
	CRR073300	Leaf 1	3.698
	CRR073301	Leaf 2	3.661
	CRR073302	Leaf 3	0.576
	CRR073303	Juvenile bud 1	0.113
	CRR073304	Juvenile bud 2	0.229
	CRR073305	Juvenile bud 3	0.202
	CRR073306	Third green 1	0.020
	CRR073307	Third green 2	0.050
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.095
	CRR073312	Silver flowering 1	0.071
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.177
	CRR073315	Gold flowering 1	0.647
	CRR073316	Gold flowering 2	2.294
	CRR073317	Gold flowering 3	0.072
	CRR073318	Tawny withering 1	0.409
	CRR073319	Tawny withering 2	1.262
	CRR073320	Tawny withering 3	0.000