Gene detail

Detail information of GWHGAAZE032365

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP15503.1	1.88086E-45	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q766Z3\|REV3_ARATH	6E-37	DNA polymerase zeta catalytic subunit
trEMBL	tr\|A0A068V6H6\|A0A068V6H6_COFCA	7E-46	DNA polymerase {ECO:0000256\|RuleBase:RU000442}
TAIR10	AT1G67500.1	1E-33	recovery protein 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000020	gene	85353	88190	+
GWHAAZE00000020	mRNA	85353	88190	+
GWHAAZE00000020	exon	85353	85410	+
GWHAAZE00000020	exon	85682	85731	+
GWHAAZE00000020	exon	85827	85963	+
GWHAAZE00000020	exon	86070	86094	+
GWHAAZE00000020	exon	87337	87411	+
GWHAAZE00000020	exon	87810	88015	+
GWHAAZE00000020	exon	88121	88190	+
GWHAAZE00000020	CDS	85353	85410	+
GWHAAZE00000020	CDS	85682	85731	+
GWHAAZE00000020	CDS	85827	85963	+
GWHAAZE00000020	CDS	86070	86094	+
GWHAAZE00000020	CDS	87337	87411	+
GWHAAZE00000020	CDS	87810	88015	+
GWHAAZE00000020	CDS	88121	88190	+

Transcript Sequence
>GWHTAAZE032403 GCATTACCTTATTTATATGTTCCATGTTTGGATCTATTGCTTCAACCAGATCAAGAAGGTGATGTATGCACAAATGTTTTATCTTTTGCTATTGAGAAAGCTTTGAAGAGTTATTGGTTGAAACTCTTACAGCTTAAAGGCAATGCTGGTTCAAAATGTCAGCACGTTCATGATTGCAGTCTTGTCCGAGCAAAGAAATTTTATGGCTATCATTCATTAGAAGAGCTATTTGCAAAAATATACCTAACTTATGAAGTCTTAAACAATGAGGTACAACGCAGAGCCCTTGACAAAAATTTAAGGTATTATCCACAGGATGTCTCTCGTGCTGCAAATCCTCTTCTGGGAGGTGCAGTTCTTGATAAGATTATACAGCCGCATGAATCACATATACCCTTCCTTCTCCAGTTCCTGGTGAGTACTGTCTTTCTGGATCAGGCTCTTGTATCAAATGATACTGATAATTGCAATATTATACTGAAGAACCACGGCCAGTTATTATCCTCTTTATTTATTGGTATTCATATTTTAATTTTACAAGTGATGTTGTGCACTATACTTGCTATGTATTGGGGAAATGGCTCTTATCTCGATGCAATAAGGCTTCTCAATTTTCAGTAG

Network for GWHGAAZE032365

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02350	REV3L, POLZ	Fanconi anemia pathway	map03460

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.293
	SRR3591706	second leaf	0.523
	SRR3591707	mature leaf	0.854
	SRR3591708	Shoot apex	0.993
	SRR3591709	Stem	0.415
	SRR3591710	White floral bud	0.444
	SRR3591711	White flower	0.666
	SRR3591712	Green floral bud	1.472
	SRR3591713	Yellow flower	0.874
SRP173429	SRR8316895	Juvenile bud stage	0.033
	SRR8316896	Juvenile bud stage	0.021
	SRR8316897	Juvenile bud stage	0.014
	SRR8316894	Third green stage	0.013
	SRR8316900	Third green stage	0.017
	SRR8316901	Third green stage	0.030
	SRR8316898	Complete white stage	0.014
	SRR8316899	Complete white stage	0.022
	SRR8316903	Complete white stage	0.006
	SRR8316902	Silver flowering stage	0.035
	SRR8316904	Silver flowering stage	0.011
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.024
	SRR8316907	Gold flowering stage	0.029
	SRR8316908	Gold flowering stage	0.127
SRP132670	SRR6706286	Control	0.003
	SRR6706287	Light intensity 50%	0.002
	SRR6706288	Light intensity 20%	0.002
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.012
	CNS0095593	Slightly white alabastrum(diploid) 2	0.032
	CNS0095594	Slightly white alabastrum(diploid) 3	0.008
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.013
	CNS0095597	Whole white alabastrum(diploid) 4	0.003
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.015
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.007
	CNS0095603	Golden flower (diploid) 3	0.008
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.117
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.021
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.004
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.287
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.240
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.011
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.228
	CRR073298	Stem 2	0.004
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.012
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.006
	CRR073311	Second white 3	0.010
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.009
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000