Gene detail

Detail information of GWHGAAZE032390

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004296576.1	3.70146E-60	PREDICTED: 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase 2-like [Fragaria vesca subsp. vesca]
Swissprot	tr\|F6HDT7\|MTND2_VITVI	3E-60	1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase 2 {ECO:0000255\|HAMAP-Rule:MF_03154}
trEMBL	tr\|V4RZF3\|V4RZF3_9ROSI	5E-60	1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase {ECO:0000256\|HAMAP-Rule:MF_03154}
TAIR10	AT4G14710.5	1E-43	RmlC-like cupins superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000021	gene	513054	515336	+
GWHAAZE00000021	mRNA	513054	515336	+
GWHAAZE00000021	exon	513054	513216	+
GWHAAZE00000021	exon	513303	513404	+
GWHAAZE00000021	exon	513828	513980	+
GWHAAZE00000021	exon	514059	514105	+
GWHAAZE00000021	exon	514901	514968	+
GWHAAZE00000021	exon	515270	515336	+
GWHAAZE00000021	CDS	513054	513216	+
GWHAAZE00000021	CDS	513303	513404	+
GWHAAZE00000021	CDS	513828	513980	+
GWHAAZE00000021	CDS	514059	514105	+
GWHAAZE00000021	CDS	514901	514968	+
GWHAAZE00000021	CDS	515270	515336	+

Transcript Sequence
>GWHTAAZE032428 ATGTTGTTTCTGTTCTCTCTCGGTATTGTGTCTTTATCAACCTTTTTGGCTTTGTGCAGGATGATAGGGAGGAAGCCATACAGGCATGGTACATGGATGATAGTGATGAAGACCAAAGACATCACTGGGATCCACCGGAATTGGTCCCTCGACAAAGTTGCTGAACTTGGAGTGCTCAGCTGGCGATTAGATGCTGATAAATATGAAACAGATGAGGAGTTGAAGAAAATTCATGAAGACCGTGGGGCGTGGATATTCCTACATGTACTGAAATTGTACCTGTATGTCAAACTTATTCTTCTGGACATGATTGAGGTTTGCCCAGAAAAGTTGCCTGACTATGAAGAGAAGATCAAAAACGTTTTTGAAGAACATCTTCACACTGATGAGGAGATCCGCTACCGTGTTGGTGGAAGTGGTTATTTCGATGTGAGGGATCAAAATGGTGCTTGGATTCGCGTATGGGCAATGCGGCTGTTTGTTGGGGATCCAATTTGGACTCCATTTAGCCGTCCACATGATCACCATGGTATAAAAGAGTATATCGAAGCCTTTGTGGAGAAGGGGGCTGGCAACAAGCCTGTTAATGCTGCAGCTTAA

Network for GWHGAAZE032390

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03079.15	ARD	39	156	1.10E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08967	mtnD, mtnZ, ADI1	Metabolic pathways	map01100
K08967	mtnD, mtnZ, ADI1	Cysteine and methionine metabolism	map00270

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0010309	molecular_function	acireductone dioxygenase [iron(II)-requiring] activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	5.139
	SRR3591706	second leaf	3.733
	SRR3591707	mature leaf	3.768
	SRR3591708	Shoot apex	6.799
	SRR3591709	Stem	11.752
	SRR3591710	White floral bud	1.996
	SRR3591711	White flower	1.351
	SRR3591712	Green floral bud	3.238
	SRR3591713	Yellow flower	0.543
SRP173429	SRR8316895	Juvenile bud stage	3.614
	SRR8316896	Juvenile bud stage	5.806
	SRR8316897	Juvenile bud stage	3.114
	SRR8316894	Third green stage	2.454
	SRR8316900	Third green stage	5.090
	SRR8316901	Third green stage	5.066
	SRR8316898	Complete white stage	0.711
	SRR8316899	Complete white stage	7.644
	SRR8316903	Complete white stage	3.262
	SRR8316902	Silver flowering stage	1.926
	SRR8316904	Silver flowering stage	3.006
	SRR8316905	Silver flowering stage	1.414
	SRR8316906	Gold flowering stage	2.832
	SRR8316907	Gold flowering stage	3.077
	SRR8316908	Gold flowering stage	2.709
SRP132670	SRR6706286	Control	6.363
	SRR6706287	Light intensity 50%	6.543
	SRR6706288	Light intensity 20%	6.791
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.870
	CNS0095593	Slightly white alabastrum(diploid) 2	8.322
	CNS0095594	Slightly white alabastrum(diploid) 3	5.392
	CNS0095595	Whole white alabastrum(diploid) 2	4.328
	CNS0095596	Whole white alabastrum(diploid) 3	4.121
	CNS0095597	Whole white alabastrum(diploid) 4	5.674
	CNS0095598	Silvery flower (diploied) 1	4.983
	CNS0095599	Silvery flower (diploied) 2	3.101
	CNS0095600	Silvery flower (diploied) 3	1.365
	CNS0095601	Golden flower (diploid) 1	6.438
	CNS0095602	Golden flower (diploid) 2	3.886
	CNS0095603	Golden flower (diploid) 3	2.239
	CNS0095604	Slightly white alabastrum(tetraploid) 1	11.201
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.008
	CNS0095606	Slightly white alabastrum(tetraploid) 3	13.377
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.803
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.149
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.631
	CNS0095610	Silvery flower (tetraploid) 1	8.769
	CNS0095611	Silvery flower (tetraploid) 2	4.133
	CNS0095612	Silvery flower (tetraploid) 3	5.468
	CNS0095613	Golden flower (tetraploid) 1	5.061
	CNS0095614	Golden flower (tetraploid) 2	5.324
	CNS0095615	Golden flower (tetraploid) 3	2.264
CRA001975	CRR073297	Stem 1	3.763
	CRR073298	Stem 2	4.089
	CRR073299	Stem 3	1.021
	CRR073300	Leaf 1	4.477
	CRR073301	Leaf 2	3.464
	CRR073302	Leaf 3	0.165
	CRR073303	Juvenile bud 1	0.698
	CRR073304	Juvenile bud 2	0.189
	CRR073305	Juvenile bud 3	0.276
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.054
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.079
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.982
	CRR073316	Gold flowering 2	0.561
	CRR073317	Gold flowering 3	0.084
	CRR073318	Tawny withering 1	0.510
	CRR073319	Tawny withering 2	1.844
	CRR073320	Tawny withering 3	0.892