Gene detail

Detail information of GWHGAAZE032399

Functional Annotation

Database	Orthologs	E value	Annotation
TAIR10	AT5G04410.1	0.0000004	NAC domain containing protein 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000021	gene	958375	959091	+
GWHAAZE00000021	mRNA	958375	959091	+
GWHAAZE00000021	exon	958375	958833	+
GWHAAZE00000021	exon	958936	959091	+
GWHAAZE00000021	CDS	958375	958833	+
GWHAAZE00000021	CDS	958936	959091	+

Transcript Sequence
>GWHTAAZE032437 ATGACGGCAAGGGCAAGGGCTCCTCCAGGATATATTTTTTTCCCACCAGAGCATGTACTGGTACGAGAGTTTTTGAATAGGAAGCTGAGAGGAGAAAGATTATGGTTTGAAGGCTGTGTGTCTGACATCGAGAGACATCATCTTTACGGCCAAAAGCCTTGGGATCTATTTGAAAAGTACGCCGAACTTCCACATCACAGATTCATTTACTTTTTCACTACTGCTACCGACAAAAATAACGCTAATACTTCTTCTGGTAATATTGTCGAACGCAACAATGGTAATGGCGGGTGTGGTGATTTGTGGATAGTTGAAAATAATGGCACTTCTTTCCCTGTGGAGGATCCTGACAACGGAAATCAAGTAGTCGGTTACAAGAAAACCTTTCTCTACGATGATTCTGATCAAGATGATATTGAGTATGAAATGACAGAATACACCTCTCTCCAACCTCCTAAAGTACCTTTTTTGGATTACGTAGTTTGCCAACTAGAGAAAATGACTGTGTATGATGATGTTGGGCGAAGAGATGGAGAAGAGGCCGCTCTTGTGTTTTCCGACGATGAAATAGTAACTGAAGATAGGGATACAGTGGTGGCAGCGGCAGCGGCGTAG

Network for GWHGAAZE032399

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	8	147	3.50E-11

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.264
	SRR3591706	second leaf	1.769
	SRR3591707	mature leaf	0.670
	SRR3591708	Shoot apex	2.020
	SRR3591709	Stem	0.980
	SRR3591710	White floral bud	17.360
	SRR3591711	White flower	10.542
	SRR3591712	Green floral bud	24.466
	SRR3591713	Yellow flower	7.997
SRP173429	SRR8316895	Juvenile bud stage	3.027
	SRR8316896	Juvenile bud stage	7.798
	SRR8316897	Juvenile bud stage	6.765
	SRR8316894	Third green stage	2.410
	SRR8316900	Third green stage	7.999
	SRR8316901	Third green stage	7.484
	SRR8316898	Complete white stage	1.292
	SRR8316899	Complete white stage	4.391
	SRR8316903	Complete white stage	2.434
	SRR8316902	Silver flowering stage	1.105
	SRR8316904	Silver flowering stage	0.377
	SRR8316905	Silver flowering stage	0.566
	SRR8316906	Gold flowering stage	0.256
	SRR8316907	Gold flowering stage	0.873
	SRR8316908	Gold flowering stage	1.502
SRP132670	SRR6706286	Control	2.370
	SRR6706287	Light intensity 50%	3.429
	SRR6706288	Light intensity 20%	3.429
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	9.970
	CNS0095593	Slightly white alabastrum(diploid) 2	6.564
	CNS0095594	Slightly white alabastrum(diploid) 3	9.285
	CNS0095595	Whole white alabastrum(diploid) 2	10.701
	CNS0095596	Whole white alabastrum(diploid) 3	12.127
	CNS0095597	Whole white alabastrum(diploid) 4	11.389
	CNS0095598	Silvery flower (diploied) 1	1.784
	CNS0095599	Silvery flower (diploied) 2	2.917
	CNS0095600	Silvery flower (diploied) 3	1.890
	CNS0095601	Golden flower (diploid) 1	0.917
	CNS0095602	Golden flower (diploid) 2	0.366
	CNS0095603	Golden flower (diploid) 3	1.107
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.330
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.964
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.087
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.850
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.555
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.607
	CNS0095610	Silvery flower (tetraploid) 1	1.819
	CNS0095611	Silvery flower (tetraploid) 2	1.359
	CNS0095612	Silvery flower (tetraploid) 3	1.315
	CNS0095613	Golden flower (tetraploid) 1	1.251
	CNS0095614	Golden flower (tetraploid) 2	1.765
	CNS0095615	Golden flower (tetraploid) 3	1.378
CRA001975	CRR073297	Stem 1	2.556
	CRR073298	Stem 2	3.732
	CRR073299	Stem 3	2.484
	CRR073300	Leaf 1	3.198
	CRR073301	Leaf 2	3.152
	CRR073302	Leaf 3	3.076
	CRR073303	Juvenile bud 1	2.527
	CRR073304	Juvenile bud 2	3.577
	CRR073305	Juvenile bud 3	1.570
	CRR073306	Third green 1	2.035
	CRR073307	Third green 2	1.083
	CRR073308	Third green 3	1.579
	CRR073309	Second white 1	0.563
	CRR073310	Second white 2	2.074
	CRR073311	Second white 3	1.569
	CRR073312	Silver flowering 1	0.994
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.705
	CRR073315	Gold flowering 1	0.838
	CRR073316	Gold flowering 2	0.640
	CRR073317	Gold flowering 3	0.307
	CRR073318	Tawny withering 1	0.993
	CRR073319	Tawny withering 2	0.857
	CRR073320	Tawny withering 3	0.761