Gene detail

Detail information of GWHGAAZE032551

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006298174.1	1.849E-96	hypothetical protein CARUB_v10014225mg [Capsella rubella]
COG	YP_006773475.1	4E-13	transcription factor TFIIB cyclin-related protein
Swissprot	tr\|Q9SS44\|TF2B2_ARATH	2E-94	Transcription initiation factor IIB-2
trEMBL	tr\|R0G675\|R0G675_9BRAS	7E-97	Uncharacterized protein {ECO:0000313\|EMBL:EOA31072.1}
TAIR10	AT3G10330.1	2E-76	Cyclin-like family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000021	gene	4538314	4541980	-
GWHAAZE00000021	mRNA	4538314	4541980	-
GWHAAZE00000021	exon	4538314	4538428	-
GWHAAZE00000021	exon	4538906	4538994	-
GWHAAZE00000021	exon	4539432	4539562	-
GWHAAZE00000021	exon	4539659	4539788	-
GWHAAZE00000021	exon	4541772	4541835	-
GWHAAZE00000021	exon	4541949	4541980	-
GWHAAZE00000021	CDS	4541949	4541980	-
GWHAAZE00000021	CDS	4541772	4541835	-
GWHAAZE00000021	CDS	4539659	4539788	-
GWHAAZE00000021	CDS	4539432	4539562	-
GWHAAZE00000021	CDS	4538906	4538994	-
GWHAAZE00000021	CDS	4538314	4538428	-

Transcript Sequence
>GWHTAAZE032589 ATGGTGCCACCAAACAACCGTCTTGCTATTAGAATTCCGTCTGTTGGTGCCTTTACCGAACAACCATTATACCAAGATGTTGGTGCAGTGCTGCTTGATCGGGCGAATGAGATATACAAAAAGGTAGAAGATCAGAAATCTAGTAGAGGAAGAAACCAGGATGCAATATTGGCTGCTTGCTTGTACATTGCTTGTCGACAAGAAGACAAGCCACGCACTGTTAAGGAAATTTGCTCTGTTGCCAATGGAGCGACAAAGAAGGAAATTGGCCGAGCAAAAGAATACATAGTAAAACAACTAGAGCTTGAGATGGGTCAGTCGGTGGAGATGGGAACCATACATGCTGGGGATTTTATGAGGCGCTTTTGTTCAAATCTTGGCATGACCAATCAAACGGTTAAAGCTGCTCAAGAATCTGTCCAAAAGTCAGAAGAGTTTGATATAAGGAGGAGCCCTATATCTATTGCTGCAGCAGTTATCTACATTGTAACTCAGCTTTCTGATGATAAGAAACCTCTCAAAGGTATAATTTATTCCATTTATTTCCTTCGTCTTAAATGA

Network for GWHGAAZE032551

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00382.20	TFIIB	33	82	2.30E-16

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03124	TFIIB, GTF2B, SUA7, tfb	Basal transcription factors	map03022

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0070897	biological_process	transcription preinitiation complex assembly
GO:0017025	molecular_function	TBP-class protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	18.399
	SRR3591706	second leaf	8.153
	SRR3591707	mature leaf	5.628
	SRR3591708	Shoot apex	12.771
	SRR3591709	Stem	14.203
	SRR3591710	White floral bud	18.331
	SRR3591711	White flower	9.781
	SRR3591712	Green floral bud	17.172
	SRR3591713	Yellow flower	9.508
SRP173429	SRR8316895	Juvenile bud stage	15.387
	SRR8316896	Juvenile bud stage	24.977
	SRR8316897	Juvenile bud stage	10.506
	SRR8316894	Third green stage	10.110
	SRR8316900	Third green stage	30.328
	SRR8316901	Third green stage	30.879
	SRR8316898	Complete white stage	17.510
	SRR8316899	Complete white stage	25.373
	SRR8316903	Complete white stage	28.928
	SRR8316902	Silver flowering stage	12.903
	SRR8316904	Silver flowering stage	21.450
	SRR8316905	Silver flowering stage	8.266
	SRR8316906	Gold flowering stage	24.951
	SRR8316907	Gold flowering stage	32.414
	SRR8316908	Gold flowering stage	22.224
SRP132670	SRR6706286	Control	17.370
	SRR6706287	Light intensity 50%	18.754
	SRR6706288	Light intensity 20%	19.629
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	22.794
	CNS0095593	Slightly white alabastrum(diploid) 2	16.093
	CNS0095594	Slightly white alabastrum(diploid) 3	21.278
	CNS0095595	Whole white alabastrum(diploid) 2	20.779
	CNS0095596	Whole white alabastrum(diploid) 3	24.141
	CNS0095597	Whole white alabastrum(diploid) 4	16.538
	CNS0095598	Silvery flower (diploied) 1	7.743
	CNS0095599	Silvery flower (diploied) 2	10.751
	CNS0095600	Silvery flower (diploied) 3	14.357
	CNS0095601	Golden flower (diploid) 1	9.360
	CNS0095602	Golden flower (diploid) 2	11.741
	CNS0095603	Golden flower (diploid) 3	9.702
	CNS0095604	Slightly white alabastrum(tetraploid) 1	17.277
	CNS0095605	Slightly white alabastrum(tetraploid) 2	19.145
	CNS0095606	Slightly white alabastrum(tetraploid) 3	14.656
	CNS0095607	Whole white alabastrum(tetraploid) 1	18.963
	CNS0095608	Whole white alabastrum(tetraploid) 2	16.967
	CNS0095609	Whole white alabastrum(tetraploid) 3	19.974
	CNS0095610	Silvery flower (tetraploid) 1	18.824
	CNS0095611	Silvery flower (tetraploid) 2	11.682
	CNS0095612	Silvery flower (tetraploid) 3	24.436
	CNS0095613	Golden flower (tetraploid) 1	12.597
	CNS0095614	Golden flower (tetraploid) 2	15.679
	CNS0095615	Golden flower (tetraploid) 3	11.497
CRA001975	CRR073297	Stem 1	19.551
	CRR073298	Stem 2	17.226
	CRR073299	Stem 3	16.634
	CRR073300	Leaf 1	24.231
	CRR073301	Leaf 2	20.061
	CRR073302	Leaf 3	24.335
	CRR073303	Juvenile bud 1	23.204
	CRR073304	Juvenile bud 2	26.743
	CRR073305	Juvenile bud 3	24.691
	CRR073306	Third green 1	16.927
	CRR073307	Third green 2	18.792
	CRR073308	Third green 3	17.179
	CRR073309	Second white 1	16.890
	CRR073310	Second white 2	14.699
	CRR073311	Second white 3	24.973
	CRR073312	Silver flowering 1	14.581
	CRR073313	Silver flowering 2	16.488
	CRR073314	Silver flowering 3	20.825
	CRR073315	Gold flowering 1	2.612
	CRR073316	Gold flowering 2	3.836
	CRR073317	Gold flowering 3	0.323
	CRR073318	Tawny withering 1	9.823
	CRR073319	Tawny withering 2	14.376
	CRR073320	Tawny withering 3	14.051