Gene detail

Detail information of GWHGAAZE032647

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002892659.1	3.5785E-26	hypothetical protein ARALYDRAFT_471336 [Arabidopsis lyrata subsp. lyrata]
trEMBL	tr\|D7KN63\|D7KN63_ARALL	1E-26	Putative uncharacterized protein {ECO:0000313\|EMBL:EFH68918.1}
TAIR10	AT1G11880.1	8E-24	transferases, transferring hexosyl groups

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000035	gene	205758	210839	+
GWHAAZE00000035	mRNA	205758	210839	+
GWHAAZE00000035	exon	205758	205940	+
GWHAAZE00000035	exon	210519	210595	+
GWHAAZE00000035	exon	210683	210839	+
GWHAAZE00000035	CDS	205758	205940	+
GWHAAZE00000035	CDS	210519	210595	+
GWHAAZE00000035	CDS	210683	210839	+

Transcript Sequence
>GWHTAAZE032685 ATGGCAGCAACGGCCATGGCATTAACATTCGCTTCCCTCGTATCGCTTCGGCTATTGAAGAGAGCATCGTGTGGGACGGCGTTTACTTCGTCCGAATCGCAAAATGCGGGGGTTACGAATACGAGCGGTCCTACGCCTTCTTGCCTCTTCTCCCTATCTCCATTTCTTTCCTCTCCAGAACAGGCTTTCACTTATTGTTTTGAAGGATCCAGAGGCGGCACGTTTTGCTTCAATCCAGCTTCCATATTTTACTCATCCATATACTCTGAGATTTTGTATGCTCTTTTATCAATTGGAGGATGTCACCTAATGTCCGGTAAAAGCAATTATGCAACACTTTGGCTTGCTCTCTCTGGATCTGCAAGGTCAAATGGGGTGCTAAATGCTGGATATATTTGCTTTCAGACTATGGATTGA

Network for GWHGAAZE032647

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04188.14	Mannosyl_trans2	75	137	1.20E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07542	PIGV	Metabolic pathways	map01100
K07542	PIGV	Glycosylphosphatidylinositol	map00563

Gene Ontology

GO term	Ontology	Name
GO:0006506	biological_process	GPI anchor biosynthetic process
GO:0004584	molecular_function	obsolete dolichyl-phosphate-mannose-glycolipid alpha-mannosyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	14.107
	SRR3591706	second leaf	21.510
	SRR3591707	mature leaf	13.133
	SRR3591708	Shoot apex	18.607
	SRR3591709	Stem	11.282
	SRR3591710	White floral bud	7.295
	SRR3591711	White flower	7.591
	SRR3591712	Green floral bud	7.711
	SRR3591713	Yellow flower	5.534
SRP173429	SRR8316895	Juvenile bud stage	2.900
	SRR8316896	Juvenile bud stage	3.008
	SRR8316897	Juvenile bud stage	1.077
	SRR8316894	Third green stage	1.151
	SRR8316900	Third green stage	3.901
	SRR8316901	Third green stage	3.512
	SRR8316898	Complete white stage	1.450
	SRR8316899	Complete white stage	3.290
	SRR8316903	Complete white stage	0.903
	SRR8316902	Silver flowering stage	0.449
	SRR8316904	Silver flowering stage	0.774
	SRR8316905	Silver flowering stage	0.200
	SRR8316906	Gold flowering stage	1.132
	SRR8316907	Gold flowering stage	1.117
	SRR8316908	Gold flowering stage	2.104
SRP132670	SRR6706286	Control	2.387
	SRR6706287	Light intensity 50%	3.535
	SRR6706288	Light intensity 20%	2.710
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.588
	CNS0095593	Slightly white alabastrum(diploid) 2	1.327
	CNS0095594	Slightly white alabastrum(diploid) 3	0.153
	CNS0095595	Whole white alabastrum(diploid) 2	1.939
	CNS0095596	Whole white alabastrum(diploid) 3	0.210
	CNS0095597	Whole white alabastrum(diploid) 4	1.149
	CNS0095598	Silvery flower (diploied) 1	1.729
	CNS0095599	Silvery flower (diploied) 2	0.655
	CNS0095600	Silvery flower (diploied) 3	1.893
	CNS0095601	Golden flower (diploid) 1	0.135
	CNS0095602	Golden flower (diploid) 2	1.302
	CNS0095603	Golden flower (diploid) 3	1.580
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.764
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.085
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.273
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.127
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.602
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.738
	CNS0095610	Silvery flower (tetraploid) 1	4.393
	CNS0095611	Silvery flower (tetraploid) 2	2.438
	CNS0095612	Silvery flower (tetraploid) 3	2.493
	CNS0095613	Golden flower (tetraploid) 1	1.913
	CNS0095614	Golden flower (tetraploid) 2	2.706
	CNS0095615	Golden flower (tetraploid) 3	2.310
CRA001975	CRR073297	Stem 1	1.267
	CRR073298	Stem 2	1.698
	CRR073299	Stem 3	0.827
	CRR073300	Leaf 1	0.946
	CRR073301	Leaf 2	0.762
	CRR073302	Leaf 3	0.154
	CRR073303	Juvenile bud 1	1.099
	CRR073304	Juvenile bud 2	0.137
	CRR073305	Juvenile bud 3	0.758
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.163
	CRR073309	Second white 1	0.018
	CRR073310	Second white 2	0.694
	CRR073311	Second white 3	0.010
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.032
	CRR073316	Gold flowering 2	0.969
	CRR073317	Gold flowering 3	0.176
	CRR073318	Tawny withering 1	0.104
	CRR073319	Tawny withering 2	0.163
	CRR073320	Tawny withering 3	0.260