Gene detail

Detail information of GWHGAAZE032819

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004137258.1	2.26117E-36	PREDICTED: receptor-like protein kinase FERONIA-like [Cucumis sativus]
Swissprot	tr\|Q9FID9\|Y5389_ARATH	9E-34	Probable receptor-like protein kinase At5g38990 (Precursor)
trEMBL	tr\|A0A0A0KZI5\|A0A0A0KZI5_CUCSA	8E-37	Uncharacterized protein {ECO:0000313\|EMBL:KGN53792.1}
TAIR10	AT5G38990.1	3E-22	Malectin/receptor-like protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000050	gene	72865	73221	+
GWHAAZE00000050	mRNA	72865	73221	+
GWHAAZE00000050	exon	72865	73221	+
GWHAAZE00000050	CDS	72865	73221	+

Transcript Sequence
>GWHTAAZE032858 ATGCGTCATCATTCCTCCTATCCTAAGTTTTCTTCCACGAAGAGACAAGTTAACCTCCCGGCAGATCAATATTGCCGTCGGTTTACATTTGCCGAGATCCGAGCAGCCACTCGCAACTTTTCCCATGGATTTGTTATCGGAAAAGGCGGATTTGGTAAGGTTTTCAAAGGTATCCTCGACAATGGAGCTACTACGGTTGCTATAAAGCGATTGGATCCCATGTCCAAACAAGGGGGTAAGGAATTTACAACTGAGATAGAAATGCTTTCTAAAATTCGACATAGCCATGTTGTTTCTCTTCTTGGTTACTGCAATGACAATGATGAAATGATCCATGGAAAATGGAAGCTTGGCTGA

Network for GWHGAAZE032819

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	45	110	2.20E-12

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_CrRLK1L-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	2.156
	SRR8316896	Juvenile bud stage	2.734
	SRR8316897	Juvenile bud stage	0.397
	SRR8316894	Third green stage	1.174
	SRR8316900	Third green stage	1.057
	SRR8316901	Third green stage	1.458
	SRR8316898	Complete white stage	0.283
	SRR8316899	Complete white stage	1.962
	SRR8316903	Complete white stage	1.354
	SRR8316902	Silver flowering stage	1.408
	SRR8316904	Silver flowering stage	4.165
	SRR8316905	Silver flowering stage	1.510
	SRR8316906	Gold flowering stage	3.034
	SRR8316907	Gold flowering stage	4.190
	SRR8316908	Gold flowering stage	1.781
SRP132670	SRR6706286	Control	3.122
	SRR6706287	Light intensity 50%	2.573
	SRR6706288	Light intensity 20%	2.395
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.298
	CNS0095593	Slightly white alabastrum(diploid) 2	0.206
	CNS0095594	Slightly white alabastrum(diploid) 3	0.585
	CNS0095595	Whole white alabastrum(diploid) 2	0.790
	CNS0095596	Whole white alabastrum(diploid) 3	0.181
	CNS0095597	Whole white alabastrum(diploid) 4	0.285
	CNS0095598	Silvery flower (diploied) 1	3.309
	CNS0095599	Silvery flower (diploied) 2	2.743
	CNS0095600	Silvery flower (diploied) 3	0.788
	CNS0095601	Golden flower (diploid) 1	0.987
	CNS0095602	Golden flower (diploid) 2	1.488
	CNS0095603	Golden flower (diploid) 3	2.474
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.306
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.315
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.568
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.396
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.739
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.987
	CNS0095610	Silvery flower (tetraploid) 1	0.635
	CNS0095611	Silvery flower (tetraploid) 2	0.129
	CNS0095612	Silvery flower (tetraploid) 3	1.366
	CNS0095613	Golden flower (tetraploid) 1	0.350
	CNS0095614	Golden flower (tetraploid) 2	0.554
	CNS0095615	Golden flower (tetraploid) 3	0.329
CRA001975	CRR073297	Stem 1	2.435
	CRR073298	Stem 2	2.547
	CRR073299	Stem 3	0.583
	CRR073300	Leaf 1	1.463
	CRR073301	Leaf 2	2.254
	CRR073302	Leaf 3	0.358
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.040
	CRR073306	Third green 1	0.060
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.110
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.031
	CRR073312	Silver flowering 1	0.466
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.448
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	4.299
	CRR073319	Tawny withering 2	1.328
	CRR073320	Tawny withering 3	0.058