Gene detail

Detail information of GWHGAAZE032870

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002527781.1	5.45088E-39	conserved hypothetical protein [Ricinus communis]
trEMBL	tr\|B9SP62\|B9SP62_RICCO	2E-39	Putative uncharacterized protein {ECO:0000313\|EMBL:EEF34591.1}
TAIR10	AT1G11880.1	7E-21	transferases, transferring hexosyl groups

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000052	gene	89552	89965	+
GWHAAZE00000052	mRNA	89552	89965	+
GWHAAZE00000052	exon	89552	89965	+
GWHAAZE00000052	CDS	89552	89965	+

Transcript Sequence
>GWHTAAZE032909 ATGACGAGGACCATTCAAAATCCAGTTGGAAAAAATCACACTCGCCTCATTTTCCGATCAGCAATCGCATCAAGACTCCTTGTCATAGCACTAATCATACTATGGAGGAATCTCCTCAGCCCCTACGACACCTCTGCATCATTAAACCCTAATAATTGCATTTCTTCTTCTTCCTCTAACAACGGCAGCAGCAGCCATGGCATTAACATTCGCTTCCCTCGCATCGCTTCGGCTATTGAAGAGAGCATCGTGTGGGACGGCGTTTATTTCGTCCGAATCGCGGAATGCGGGGGTTACGAATACGAGCAGTCCTATGCCTTCTTGCCTCTTCTCCCTATGTCCATTTCTTTCCTCTCCAGAACAGGTTTGTTAGTTGGTCACTCAATTTTGACTGGTTTTGGTTTTGGTTTTTGA

Network for GWHGAAZE032870

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04188.14	Mannosyl_trans2	18	121	1.80E-20

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07542	PIGV	Metabolic pathways	map01100
K07542	PIGV	Glycosylphosphatidylinositol	map00563

Gene Ontology

GO term	Ontology	Name
GO:0006506	biological_process	GPI anchor biosynthetic process
GO:0004584	molecular_function	obsolete dolichyl-phosphate-mannose-glycolipid alpha-mannosyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.541
	SRR3591706	second leaf	0.368
	SRR3591707	mature leaf	0.936
	SRR3591708	Shoot apex	0.444
	SRR3591709	Stem	0.825
	SRR3591710	White floral bud	0.231
	SRR3591711	White flower	0.537
	SRR3591712	Green floral bud	0.256
	SRR3591713	Yellow flower	0.228
SRP173429	SRR8316895	Juvenile bud stage	0.428
	SRR8316896	Juvenile bud stage	1.062
	SRR8316897	Juvenile bud stage	0.119
	SRR8316894	Third green stage	0.403
	SRR8316900	Third green stage	0.753
	SRR8316901	Third green stage	1.164
	SRR8316898	Complete white stage	0.553
	SRR8316899	Complete white stage	0.410
	SRR8316903	Complete white stage	1.191
	SRR8316902	Silver flowering stage	0.232
	SRR8316904	Silver flowering stage	0.253
	SRR8316905	Silver flowering stage	0.132
	SRR8316906	Gold flowering stage	0.436
	SRR8316907	Gold flowering stage	0.120
	SRR8316908	Gold flowering stage	0.057
SRP132670	SRR6706286	Control	2.008
	SRR6706287	Light intensity 50%	2.689
	SRR6706288	Light intensity 20%	3.007
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.296
	CNS0095593	Slightly white alabastrum(diploid) 2	0.630
	CNS0095594	Slightly white alabastrum(diploid) 3	0.401
	CNS0095595	Whole white alabastrum(diploid) 2	0.391
	CNS0095596	Whole white alabastrum(diploid) 3	0.323
	CNS0095597	Whole white alabastrum(diploid) 4	0.213
	CNS0095598	Silvery flower (diploied) 1	0.610
	CNS0095599	Silvery flower (diploied) 2	0.662
	CNS0095600	Silvery flower (diploied) 3	0.096
	CNS0095601	Golden flower (diploid) 1	0.145
	CNS0095602	Golden flower (diploid) 2	0.102
	CNS0095603	Golden flower (diploid) 3	0.291
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.397
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.435
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.772
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.794
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.108
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.117
	CNS0095610	Silvery flower (tetraploid) 1	0.738
	CNS0095611	Silvery flower (tetraploid) 2	0.208
	CNS0095612	Silvery flower (tetraploid) 3	0.006
	CNS0095613	Golden flower (tetraploid) 1	0.155
	CNS0095614	Golden flower (tetraploid) 2	0.034
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	1.886
	CRR073298	Stem 2	0.715
	CRR073299	Stem 3	0.241
	CRR073300	Leaf 1	1.917
	CRR073301	Leaf 2	1.037
	CRR073302	Leaf 3	0.099
	CRR073303	Juvenile bud 1	0.056
	CRR073304	Juvenile bud 2	0.972
	CRR073305	Juvenile bud 3	0.715
	CRR073306	Third green 1	0.019
	CRR073307	Third green 2	0.183
	CRR073308	Third green 3	0.163
	CRR073309	Second white 1	0.224
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.012
	CRR073312	Silver flowering 1	0.182
	CRR073313	Silver flowering 2	0.127
	CRR073314	Silver flowering 3	0.068
	CRR073315	Gold flowering 1	0.148
	CRR073316	Gold flowering 2	0.755
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.615
	CRR073319	Tawny withering 2	0.219
	CRR073320	Tawny withering 3	0.114