Gene detail

Detail information of GWHGAAZE032968

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009762374.1	1.22357E-22	PREDICTED: GPI mannosyltransferase 2 [Nicotiana sylvestris]
trEMBL	tr\|B9SP62\|B9SP62_RICCO	7E-22	Putative uncharacterized protein {ECO:0000313\|EMBL:EEF34591.1}
TAIR10	AT1G11880.1	0.00009	transferases, transferring hexosyl groups

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000077	gene	119489	119981	+
GWHAAZE00000077	mRNA	119489	119981	+
GWHAAZE00000077	exon	119489	119529	+
GWHAAZE00000077	exon	119693	119981	+
GWHAAZE00000077	CDS	119489	119529	+
GWHAAZE00000077	CDS	119693	119981	+

Transcript Sequence
>GWHTAAZE033007 ATGATGAGCCGAAGTCCCCCAAAAGTAATCGCCGCACCACCCCCCTACGACACCTCTGCATCATTAAACCCTAATAATTGCATCTCTTCTTCCTCCTCCAACAATGGCAGCAGCAGCCATGGCATTAACATTCTCTTCCCTCGCAGTGCTTCAGCTATTGAAGAGAGCATCGCGTGGGACGGCGTCTACTTCGTCCTAATCGCGCAATGCGGGGGTTACGAATACGAGCAGTCCTTCGCCTTCTTGCCTCTTCTCCCTATCTCCATTTCTTTCCTCTCCACAACAGGTTTGTTAGTTGGTCACTCAATTTTGACTGGTTTTGGTTTTTGA

Network for GWHGAAZE032968

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04188.14	Mannosyl_trans2	15	94	2.70E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07542	PIGV	Metabolic pathways	map01100
K07542	PIGV	Glycosylphosphatidylinositol	map00563

Gene Ontology

GO term	Ontology	Name
GO:0006506	biological_process	GPI anchor biosynthetic process
GO:0004584	molecular_function	obsolete dolichyl-phosphate-mannose-glycolipid alpha-mannosyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.950
	SRR3591706	second leaf	0.740
	SRR3591707	mature leaf	0.736
	SRR3591708	Shoot apex	0.795
	SRR3591709	Stem	0.591
	SRR3591710	White floral bud	1.407
	SRR3591711	White flower	1.431
	SRR3591712	Green floral bud	2.420
	SRR3591713	Yellow flower	1.102
SRP173429	SRR8316895	Juvenile bud stage	1.266
	SRR8316896	Juvenile bud stage	3.053
	SRR8316897	Juvenile bud stage	0.761
	SRR8316894	Third green stage	1.698
	SRR8316900	Third green stage	3.496
	SRR8316901	Third green stage	3.732
	SRR8316898	Complete white stage	0.231
	SRR8316899	Complete white stage	1.131
	SRR8316903	Complete white stage	1.622
	SRR8316902	Silver flowering stage	0.869
	SRR8316904	Silver flowering stage	0.816
	SRR8316905	Silver flowering stage	0.837
	SRR8316906	Gold flowering stage	1.181
	SRR8316907	Gold flowering stage	1.531
	SRR8316908	Gold flowering stage	0.945
SRP132670	SRR6706286	Control	5.672
	SRR6706287	Light intensity 50%	4.892
	SRR6706288	Light intensity 20%	6.057
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.182
	CNS0095593	Slightly white alabastrum(diploid) 2	3.271
	CNS0095594	Slightly white alabastrum(diploid) 3	2.641
	CNS0095595	Whole white alabastrum(diploid) 2	5.759
	CNS0095596	Whole white alabastrum(diploid) 3	4.288
	CNS0095597	Whole white alabastrum(diploid) 4	6.416
	CNS0095598	Silvery flower (diploied) 1	1.129
	CNS0095599	Silvery flower (diploied) 2	0.483
	CNS0095600	Silvery flower (diploied) 3	2.010
	CNS0095601	Golden flower (diploid) 1	1.066
	CNS0095602	Golden flower (diploid) 2	1.068
	CNS0095603	Golden flower (diploid) 3	1.305
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.092
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.457
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.478
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.302
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.194
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.796
	CNS0095610	Silvery flower (tetraploid) 1	0.155
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.183
	CNS0095613	Golden flower (tetraploid) 1	0.049
	CNS0095614	Golden flower (tetraploid) 2	0.069
	CNS0095615	Golden flower (tetraploid) 3	0.115
CRA001975	CRR073297	Stem 1	4.203
	CRR073298	Stem 2	2.722
	CRR073299	Stem 3	1.493
	CRR073300	Leaf 1	5.388
	CRR073301	Leaf 2	4.085
	CRR073302	Leaf 3	2.083
	CRR073303	Juvenile bud 1	2.707
	CRR073304	Juvenile bud 2	2.516
	CRR073305	Juvenile bud 3	0.595
	CRR073306	Third green 1	1.631
	CRR073307	Third green 2	0.400
	CRR073308	Third green 3	1.709
	CRR073309	Second white 1	0.568
	CRR073310	Second white 2	0.687
	CRR073311	Second white 3	0.665
	CRR073312	Silver flowering 1	0.149
	CRR073313	Silver flowering 2	0.531
	CRR073314	Silver flowering 3	0.095
	CRR073315	Gold flowering 1	0.675
	CRR073316	Gold flowering 2	0.259
	CRR073317	Gold flowering 3	0.630
	CRR073318	Tawny withering 1	0.590
	CRR073319	Tawny withering 2	0.268
	CRR073320	Tawny withering 3	2.338