Gene detail

Detail information of GWHGAAZE033008

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011099071.1	1.81979E-62	PREDICTED: basic leucine zipper 43 [Sesamum indicum]
Swissprot	tr\|Q9FMC2\|BZP43_ARATH	1E-38	Basic leucine zipper 43
trEMBL	tr\|A5ANJ4\|A5ANJ4_VITVI	3E-59	Putative uncharacterized protein {ECO:0000313\|EMBL:CAN66938.1}
TAIR10	AT3G30530.1	7E-37	basic leucine-zipper 42

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000081	gene	1240648	1241106	+
GWHAAZE00000081	mRNA	1240648	1241106	+
GWHAAZE00000081	exon	1240648	1241106	+
GWHAAZE00000081	CDS	1240648	1241106	+

Transcript Sequence
>GWHTAAZE033047 ATGCAATCCAATGAAGTTGCACAACTCCATTACCCGGTTCATTTTAGCATGACCCAAAACGACGCACCCGCATTTGATCGTCACCTCTTTAACCCATTATACCATTTCCAAATCACTCCTCAACTCCAAGAACTCAACAACCCTCGACAAACATATTTCAGCAATTCCACTTCAGACGAAGCGGACGAGCAACAGCAGAGTCTGGTCGACTTGAGAAAGCAGAGGAGAATGATATCTAACAGAGAGTCTGCGCGCAGATCACGTATGCGCAAGCAAAGGCACCTTGATGAACTATGGTCACAAGTTATGTGGCTTAGAAACGAGAACCGACAACTCATTGAAAAACTAAATGATTTATTGGATCAACACGATCAATTTGTTCAAGAGAATGCGCAGCTGAAAGAAGAAGCTTCCGAGCTTCGCCAACTGATCGCTAATATGCAGCTTAATAGTCCTTGA

Network for GWHGAAZE033008

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00170.22	bZIP_1	71	124	3.40E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bZIP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.792
	SRR3591706	second leaf	0.917
	SRR3591707	mature leaf	2.494
	SRR3591708	Shoot apex	7.089
	SRR3591709	Stem	49.980
	SRR3591710	White floral bud	8.443
	SRR3591711	White flower	2.280
	SRR3591712	Green floral bud	11.472
	SRR3591713	Yellow flower	2.814
SRP173429	SRR8316895	Juvenile bud stage	5.190
	SRR8316896	Juvenile bud stage	4.192
	SRR8316897	Juvenile bud stage	1.591
	SRR8316894	Third green stage	5.419
	SRR8316900	Third green stage	16.482
	SRR8316901	Third green stage	11.854
	SRR8316898	Complete white stage	1.380
	SRR8316899	Complete white stage	5.431
	SRR8316903	Complete white stage	3.072
	SRR8316902	Silver flowering stage	1.247
	SRR8316904	Silver flowering stage	4.701
	SRR8316905	Silver flowering stage	0.893
	SRR8316906	Gold flowering stage	1.853
	SRR8316907	Gold flowering stage	2.407
	SRR8316908	Gold flowering stage	5.427
SRP132670	SRR6706286	Control	16.654
	SRR6706287	Light intensity 50%	16.335
	SRR6706288	Light intensity 20%	13.932
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.619
	CNS0095593	Slightly white alabastrum(diploid) 2	8.013
	CNS0095594	Slightly white alabastrum(diploid) 3	7.309
	CNS0095595	Whole white alabastrum(diploid) 2	6.186
	CNS0095596	Whole white alabastrum(diploid) 3	15.303
	CNS0095597	Whole white alabastrum(diploid) 4	3.489
	CNS0095598	Silvery flower (diploied) 1	0.916
	CNS0095599	Silvery flower (diploied) 2	2.116
	CNS0095600	Silvery flower (diploied) 3	2.993
	CNS0095601	Golden flower (diploid) 1	1.198
	CNS0095602	Golden flower (diploid) 2	13.243
	CNS0095603	Golden flower (diploid) 3	11.344
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.688
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.693
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.998
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.247
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.968
	CNS0095609	Whole white alabastrum(tetraploid) 3	11.558
	CNS0095610	Silvery flower (tetraploid) 1	2.969
	CNS0095611	Silvery flower (tetraploid) 2	7.409
	CNS0095612	Silvery flower (tetraploid) 3	7.101
	CNS0095613	Golden flower (tetraploid) 1	2.736
	CNS0095614	Golden flower (tetraploid) 2	2.741
	CNS0095615	Golden flower (tetraploid) 3	5.277
CRA001975	CRR073297	Stem 1	1.915
	CRR073298	Stem 2	1.522
	CRR073299	Stem 3	2.865
	CRR073300	Leaf 1	4.253
	CRR073301	Leaf 2	5.675
	CRR073302	Leaf 3	5.150
	CRR073303	Juvenile bud 1	12.766
	CRR073304	Juvenile bud 2	14.664
	CRR073305	Juvenile bud 3	8.030
	CRR073306	Third green 1	1.316
	CRR073307	Third green 2	7.083
	CRR073308	Third green 3	9.149
	CRR073309	Second white 1	0.817
	CRR073310	Second white 2	0.834
	CRR073311	Second white 3	0.194
	CRR073312	Silver flowering 1	0.877
	CRR073313	Silver flowering 2	2.021
	CRR073314	Silver flowering 3	1.610
	CRR073315	Gold flowering 1	0.130
	CRR073316	Gold flowering 2	0.443
	CRR073317	Gold flowering 3	0.547
	CRR073318	Tawny withering 1	17.362
	CRR073319	Tawny withering 2	7.533
	CRR073320	Tawny withering 3	10.463