Gene detail

Detail information of GWHGAAZE033033

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002283435.1	1.28835E-90	PREDICTED: GPI mannosyltransferase 2 [Vitis vinifera]
trEMBL	tr\|D7SLG2\|D7SLG2_VITVI	5E-91	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI16490.3}
TAIR10	AT1G11880.1	7E-70	transferases, transferring hexosyl groups

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000085	gene	2235	5896	-
GWHAAZE00000085	mRNA	2235	5896	-
GWHAAZE00000085	exon	5753	5896	-
GWHAAZE00000085	exon	3785	3963	-
GWHAAZE00000085	exon	2235	2484	-
GWHAAZE00000085	CDS	5753	5896	-
GWHAAZE00000085	CDS	3785	3963	-
GWHAAZE00000085	CDS	2235	2484	-

Transcript Sequence
>GWHTAAZE033072 ATGTCTGGTAAAAGCAATTATGCAACACTTTGGCTTGCTCTCTCTGGATCTGCAAGGTCAAATGGGGTGCTAAATGCTGGATATATTTGCTTTCAGACTATGCACCGAGCTTATGATGCTATCTTTGTTAATAAGCGATATTACTTGGCAGTGCAGGTTCTTATCGCGGGAGCTTTGCGTTCTATTTGTGTTTTTGTTCCATTTATTGCTTTTCAAGCATATGGCTACTATAATATTTGTCTTGGGCGTTCTGTGGAGGAAACTAGGCTGTGGTGCAAGGCAAGAATTCCTTTGCTGTACAATTTTATTCAGAGTCACTATTGGGGAGTAGGGTTTTTAAGATATTTCCAGCTAAAACAGTTGCCAAATTTCCTACTTGCTTTCCCAATATTGTCACTAGCTGTTTGTTCAATCATGTACTATGCGAAGCTACGAAGGGAGGTTTTTCTCTCACTTGGTTTCCGAGCTTCTCCTGTGGATAAGAAGTCTGCTGCTGTGTTCTTTTCTGTGGGGACAGAGTCAAGATCAAAAAGTGAATCTATTTTAGAGAAAGAAACTACTAAAATACGTGAA

Network for GWHGAAZE033033

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04188.14	Mannosyl_trans2	2	165	5.60E-63

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07542	PIGV	Metabolic pathways	map01100
K07542	PIGV	Glycosylphosphatidylinositol	map00563

Gene Ontology

GO term	Ontology	Name
GO:0006506	biological_process	GPI anchor biosynthetic process
GO:0004584	molecular_function	obsolete dolichyl-phosphate-mannose-glycolipid alpha-mannosyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.373
	SRR3591706	second leaf	2.862
	SRR3591707	mature leaf	4.786
	SRR3591708	Shoot apex	5.848
	SRR3591709	Stem	2.161
	SRR3591710	White floral bud	6.164
	SRR3591711	White flower	3.847
	SRR3591712	Green floral bud	5.602
	SRR3591713	Yellow flower	3.022
SRP173429	SRR8316895	Juvenile bud stage	4.165
	SRR8316896	Juvenile bud stage	7.348
	SRR8316897	Juvenile bud stage	2.618
	SRR8316894	Third green stage	3.245
	SRR8316900	Third green stage	7.018
	SRR8316901	Third green stage	7.761
	SRR8316898	Complete white stage	2.084
	SRR8316899	Complete white stage	4.468
	SRR8316903	Complete white stage	4.687
	SRR8316902	Silver flowering stage	2.273
	SRR8316904	Silver flowering stage	2.691
	SRR8316905	Silver flowering stage	1.883
	SRR8316906	Gold flowering stage	4.336
	SRR8316907	Gold flowering stage	5.400
	SRR8316908	Gold flowering stage	3.001
SRP132670	SRR6706286	Control	1.927
	SRR6706287	Light intensity 50%	1.711
	SRR6706288	Light intensity 20%	2.579
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.947
	CNS0095593	Slightly white alabastrum(diploid) 2	4.960
	CNS0095594	Slightly white alabastrum(diploid) 3	4.412
	CNS0095595	Whole white alabastrum(diploid) 2	7.733
	CNS0095596	Whole white alabastrum(diploid) 3	4.665
	CNS0095597	Whole white alabastrum(diploid) 4	6.723
	CNS0095598	Silvery flower (diploied) 1	4.082
	CNS0095599	Silvery flower (diploied) 2	3.389
	CNS0095600	Silvery flower (diploied) 3	3.864
	CNS0095601	Golden flower (diploid) 1	4.432
	CNS0095602	Golden flower (diploid) 2	4.292
	CNS0095603	Golden flower (diploid) 3	3.002
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.696
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.167
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.666
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.083
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.314
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.595
	CNS0095610	Silvery flower (tetraploid) 1	3.001
	CNS0095611	Silvery flower (tetraploid) 2	2.543
	CNS0095612	Silvery flower (tetraploid) 3	2.065
	CNS0095613	Golden flower (tetraploid) 1	1.577
	CNS0095614	Golden flower (tetraploid) 2	3.191
	CNS0095615	Golden flower (tetraploid) 3	1.365
CRA001975	CRR073297	Stem 1	1.104
	CRR073298	Stem 2	1.847
	CRR073299	Stem 3	0.881
	CRR073300	Leaf 1	2.008
	CRR073301	Leaf 2	1.524
	CRR073302	Leaf 3	0.522
	CRR073303	Juvenile bud 1	0.746
	CRR073304	Juvenile bud 2	0.651
	CRR073305	Juvenile bud 3	0.454
	CRR073306	Third green 1	1.793
	CRR073307	Third green 2	0.279
	CRR073308	Third green 3	0.796
	CRR073309	Second white 1	2.284
	CRR073310	Second white 2	0.165
	CRR073311	Second white 3	2.139
	CRR073312	Silver flowering 1	0.954
	CRR073313	Silver flowering 2	0.735
	CRR073314	Silver flowering 3	1.684
	CRR073315	Gold flowering 1	0.821
	CRR073316	Gold flowering 2	2.268
	CRR073317	Gold flowering 3	2.002
	CRR073318	Tawny withering 1	0.424
	CRR073319	Tawny withering 2	0.123
	CRR073320	Tawny withering 3	2.255