Gene detail

Detail information of GWHGAAZE033192

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EMT03939.1	2.41246E-49	SKP1-like protein 1B [Aegilops tauschii]
Swissprot	tr\|Q9LNT9\|ASK4_ARATH	5E-45	SKP1-like protein 4
trEMBL	tr\|M8AR91\|M8AR91_AEGTA	9E-50	SKP1-like protein 1B {ECO:0000313\|EMBL:EMT03939.1}
TAIR10	AT1G20140.1	7E-37	SKP1-like 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000094	gene	2742077	2743309	+
GWHAAZE00000094	mRNA	2742077	2743309	+
GWHAAZE00000094	exon	2742077	2742575	+
GWHAAZE00000094	exon	2743188	2743309	+
GWHAAZE00000094	CDS	2742077	2742575	+
GWHAAZE00000094	CDS	2743188	2743309	+

Transcript Sequence
>GWHTAAZE033231 ATGTCTGAGAATAAATTGATGGTGACGGAATTGGGGAAGTTGAAGATCTCGGAGGAGAAGAAGAAATTGGTGACGCTGAAGAGCTCTGATGAACAGGAATTCGTGGTTGAAGAGTCGATCATTCTTCAATCGGATATGATTAAGAATACAATCGAAGATTGTGAACTCGATTCGATTAATCTGCCGAATGTTGATGGCAAGACCTTGGGGAAGGTGATCGAGTACTGCAATAAACATGCTAGTCAGAATGGAGATCTGAGTAAGTTTGATGAGGAGTTTTTGGATGTGGGTCAGGCTGTTTTGTTCGATTTGATAATGGCGGCTAATTACCTTAGTCTTAGGGGTTTGGTGGATAAGATATGTAGGAAGGTTGCTAGTATGATGAAAGGGAAGAGTCCGGAGGAGATTAGGGATATTTTAGAGATTGAGAATGATTTTGAACCTGAACAAGAGAAGGAAATCCGCGCGGAGAATGCTTGGGCTTTTGAGGATTATTGTGGGTGGGCGTGTCGCTGGCTTCTATTAGTTTCTGATTTACCTGATCAAGGGTTCCACTGTTGGAATAGAAATCTTATTACGGATAGTGAACAGCTGAAAATATCATCATCCCTCTTTTCTTAG

Network for GWHGAAZE033192

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03931.16	Skp1_POZ	23	80	2.20E-18
PF01466.20	Skp1	115	161	5.30E-21

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	SKP1

KEGG pathway

KO	Enzyme	pathway	mapID
K03094	SKP1, CBF3D	Protein processing in endoplasmic reticulum	map04141
		Ubiquitin mediated proteolysis	map04120
		Wnt signaling pathway	map04310
		Hedgehog signaling pathway - fly	map04341
		TGF-beta signaling pathway	map04350
		Cell cycle	map04110
		Cell cycle - yeast	map04111
		Oocyte meiosis	map04114
		Circadian rhythm	map04710

Gene Ontology

GO term	Ontology	Name
GO:0006511	biological_process	ubiquitin-dependent protein catabolic process

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	12.298
	SRR3591706	second leaf	1.877
	SRR3591707	mature leaf	1.359
	SRR3591708	Shoot apex	11.142
	SRR3591709	Stem	5.939
	SRR3591710	White floral bud	5.648
	SRR3591711	White flower	4.005
	SRR3591712	Green floral bud	10.354
	SRR3591713	Yellow flower	1.985
SRP173429	SRR8316895	Juvenile bud stage	8.149
	SRR8316896	Juvenile bud stage	10.696
	SRR8316897	Juvenile bud stage	4.316
	SRR8316894	Third green stage	5.377
	SRR8316900	Third green stage	15.367
	SRR8316901	Third green stage	14.320
	SRR8316898	Complete white stage	1.295
	SRR8316899	Complete white stage	6.286
	SRR8316903	Complete white stage	2.129
	SRR8316902	Silver flowering stage	0.920
	SRR8316904	Silver flowering stage	2.044
	SRR8316905	Silver flowering stage	0.318
	SRR8316906	Gold flowering stage	1.572
	SRR8316907	Gold flowering stage	1.520
	SRR8316908	Gold flowering stage	1.892
SRP132670	SRR6706286	Control	4.910
	SRR6706287	Light intensity 50%	6.061
	SRR6706288	Light intensity 20%	7.033
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.918
	CNS0095593	Slightly white alabastrum(diploid) 2	13.761
	CNS0095594	Slightly white alabastrum(diploid) 3	11.681
	CNS0095595	Whole white alabastrum(diploid) 2	9.521
	CNS0095596	Whole white alabastrum(diploid) 3	9.888
	CNS0095597	Whole white alabastrum(diploid) 4	11.718
	CNS0095598	Silvery flower (diploied) 1	5.441
	CNS0095599	Silvery flower (diploied) 2	1.983
	CNS0095600	Silvery flower (diploied) 3	3.135
	CNS0095601	Golden flower (diploid) 1	3.533
	CNS0095602	Golden flower (diploid) 2	3.691
	CNS0095603	Golden flower (diploid) 3	2.981
	CNS0095604	Slightly white alabastrum(tetraploid) 1	10.404
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.323
	CNS0095606	Slightly white alabastrum(tetraploid) 3	14.297
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.956
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.099
	CNS0095609	Whole white alabastrum(tetraploid) 3	11.145
	CNS0095610	Silvery flower (tetraploid) 1	2.853
	CNS0095611	Silvery flower (tetraploid) 2	2.378
	CNS0095612	Silvery flower (tetraploid) 3	2.394
	CNS0095613	Golden flower (tetraploid) 1	1.977
	CNS0095614	Golden flower (tetraploid) 2	2.349
	CNS0095615	Golden flower (tetraploid) 3	1.001
CRA001975	CRR073297	Stem 1	10.121
	CRR073298	Stem 2	14.011
	CRR073299	Stem 3	7.171
	CRR073300	Leaf 1	9.947
	CRR073301	Leaf 2	8.419
	CRR073302	Leaf 3	6.490
	CRR073303	Juvenile bud 1	11.035
	CRR073304	Juvenile bud 2	3.815
	CRR073305	Juvenile bud 3	8.090
	CRR073306	Third green 1	0.826
	CRR073307	Third green 2	0.139
	CRR073308	Third green 3	0.648
	CRR073309	Second white 1	0.405
	CRR073310	Second white 2	1.213
	CRR073311	Second white 3	0.390
	CRR073312	Silver flowering 1	0.767
	CRR073313	Silver flowering 2	1.245
	CRR073314	Silver flowering 3	1.015
	CRR073315	Gold flowering 1	3.169
	CRR073316	Gold flowering 2	5.455
	CRR073317	Gold flowering 3	2.920
	CRR073318	Tawny withering 1	9.126
	CRR073319	Tawny withering 2	6.814
	CRR073320	Tawny withering 3	6.866