Gene detail

Detail information of GWHGAAZE033208

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU34695.1	3.66954E-75	hypothetical protein MIMGU_mgv1a024051mg, partial [Erythranthe guttata]
COG	YP_822503.1	4E-28	peptidase M10A and M12B, matrixin and adamalysin
Swissprot	tr\|P29136\|MEP1_SOYBN	7E-50	Metalloendoproteinase 1 (Precursor)
trEMBL	tr\|A0A022R746\|A0A022R746_ERYGU	1E-75	Uncharacterized protein {ECO:0000313\|EMBL:EYU34695.1} (Fragment)
TAIR10	AT1G59970.1	4E-30	Matrixin family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000094	gene	2943590	2944265	-
GWHAAZE00000094	mRNA	2943590	2944265	-
GWHAAZE00000094	exon	2943590	2944138	-
GWHAAZE00000094	exon	2944218	2944265	-
GWHAAZE00000094	CDS	2944218	2944265	-
GWHAAZE00000094	CDS	2943590	2944138	-

Transcript Sequence
>GWHTAAZE033247 ATGAAGCCGTCAAAACCTACCAACTCAATTATCATCTTAACACCACTGGATGCGTGCCGGCAAGAAAAAGCACCACCATGGCTCTCATTCACTTCATACGTTTCTCACTATACTTTCTTTCAAGGATTTCCGAGATGGCCAGCTTCTAAGACCCACCTTACCTTTGCGTTTTCACGAGGGACCGGCGATCCTGATGCAGTCAACCCTATTACGCGAGCTTTTACCAGATGGGCTCGTACAACACATTTTACATTTTCGGGGACTGAAGATTATTTGAATGCCGATATAAAGATTAGTTTCCATAGAGGTAACCATGGAGATGGTCACCCATTTTACGGTCGTGGTGGAGCCACGGCTCATGCTTTTGCACCGACCGATGGAAGGTTTCACTATGATGCCGATGAATTGTGGTCTGAGGGTCCAGTCTCCGGAGCTTTTGATTTAGAGACTGTTGCCTTGCATGAAATTGGGCACCTTCTTGGACTTGGGCATAGCTCGGTTGAGGACGCAATCATGTATTCTTATATTTCACCAGGAACAACTAAAGGTCTACATGGGGACGATGTTCAAGGAATTAGGGCTTTATATAATGTTTGA

Network for GWHGAAZE033208

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0164

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00413.25	Peptidase_M10	49	196	6.30E-42

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0031012	cellular_component	extracellular matrix
GO:0008237	molecular_function	metallopeptidase activity
GO:0008270	molecular_function	zinc ion binding
GO:0004222	molecular_function	metalloendopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.022
	SRR3591707	mature leaf	0.588
	SRR3591708	Shoot apex	0.269
	SRR3591709	Stem	0.395
	SRR3591710	White floral bud	0.649
	SRR3591711	White flower	0.528
	SRR3591712	Green floral bud	0.452
	SRR3591713	Yellow flower	1.230
SRP173429	SRR8316895	Juvenile bud stage	0.111
	SRR8316896	Juvenile bud stage	0.107
	SRR8316897	Juvenile bud stage	0.089
	SRR8316894	Third green stage	0.019
	SRR8316900	Third green stage	0.185
	SRR8316901	Third green stage	0.077
	SRR8316898	Complete white stage	0.231
	SRR8316899	Complete white stage	0.261
	SRR8316903	Complete white stage	0.112
	SRR8316902	Silver flowering stage	0.355
	SRR8316904	Silver flowering stage	0.529
	SRR8316905	Silver flowering stage	0.161
	SRR8316906	Gold flowering stage	1.118
	SRR8316907	Gold flowering stage	0.470
	SRR8316908	Gold flowering stage	0.267
SRP132670	SRR6706286	Control	1.209
	SRR6706287	Light intensity 50%	0.867
	SRR6706288	Light intensity 20%	0.373
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.059
	CNS0095593	Slightly white alabastrum(diploid) 2	0.056
	CNS0095594	Slightly white alabastrum(diploid) 3	0.179
	CNS0095595	Whole white alabastrum(diploid) 2	0.059
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.128
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.126
	CNS0095600	Silvery flower (diploied) 3	0.417
	CNS0095601	Golden flower (diploid) 1	0.058
	CNS0095602	Golden flower (diploid) 2	0.212
	CNS0095603	Golden flower (diploid) 3	0.234
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.070
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.723
	CRR073298	Stem 2	0.376
	CRR073299	Stem 3	0.183
	CRR073300	Leaf 1	0.099
	CRR073301	Leaf 2	0.440
	CRR073302	Leaf 3	0.077
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.111
	CRR073306	Third green 1	0.119
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.275
	CRR073309	Second white 1	0.106
	CRR073310	Second white 2	0.210
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.032
	CRR073313	Silver flowering 2	0.103
	CRR073314	Silver flowering 3	0.062
	CRR073315	Gold flowering 1	0.061
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.374
	CRR073318	Tawny withering 1	0.910
	CRR073319	Tawny withering 2	1.260
	CRR073320	Tawny withering 3	0.398