Gene detail

Detail information of GWHGAAZE033211

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007010413.1	4.9464E-110	Matrixin family protein [Theobroma cacao]
COG	YP_006179981.1	8E-25	M10 family peptidase
Swissprot	tr\|P29136\|MEP1_SOYBN	5E-51	Metalloendoproteinase 1 (Precursor)
trEMBL	tr\|S1SMU3\|S1SMU3_THECC	2E-110	Matrixin family protein {ECO:0000313\|EMBL:EOY20464.1}
TAIR10	AT1G59970.1	1E-41	Matrixin family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000094	gene	2978105	2978881	-
GWHAAZE00000094	mRNA	2978105	2978881	-
GWHAAZE00000094	exon	2978105	2978881	-
GWHAAZE00000094	CDS	2978105	2978881	-

Transcript Sequence
>GWHTAAZE033250 ATGGCAATTAAAGTTTCCCATCTCTTTTTATGCATCTTCCTCCTTCTCCCTCTCCTGTCTAATTCAAAGTTAGAGGAGAACAATGGTGAAAAGCCATCATCGCCCTTTGAGTTTCTCAAGCATTTGCAAGGGTGCCACAAGGGAGACAAGCTAAAAGGTGTCCATAACCTTAAACAATACCTCAAGAATTTTGGTTACCTAAACTATCCCAAAAATTACTCCCATTGCGACGATGACGATTTTGATGATTTCTTAGAGGAAGCCGTCAAAACCTACCAACTCAATTATCATCTTAATGCCACGGGTACCTTAGATGCTCAAACAGTATCAAAGATGATTACACCTCGATGCGGTGTGGCTGATATTATCAATGGTACAAATGGGATGCGCGCGGGCAAGAAAAAGCACCATCATGGCTCTCATTCACTTCATACAGTTTCTCACTATACTTTCTTTCAAGGATTTCCAAGATGGCCAGCTTCTAAGACCCACCTTACCTTTGGGTTTTCACGCGGGACCCATCCTAATGTGGTCAACCCTGTTACACGAGCTTTTAAAAGTTGGGCTGGTACAACACATTTTACATTTTCGCAGACCGAAGATTATTTGAATGCCGATATAAAGATTAGTTTCCATAGTGGTAGCCACGGAGATGGTCAGCCATTTGATGGTCGTGGTGGAACACTGGCTCATGCTTGGGCACCAACCGATGGAAGGTTTCACTATGATGCCGATGAATTGTGGTCTATCGGTCCAGTCTCGGAGCTTATGATTTAG

Network for GWHGAAZE033211

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0165

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01471.19	PG_binding_1	53	112	4.70E-13
PF00413.25	Peptidase_M10	164	251	1.40E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0031012	cellular_component	extracellular matrix
GO:0008237	molecular_function	metallopeptidase activity
GO:0004222	molecular_function	metalloendopeptidase activity
GO:0008270	molecular_function	zinc ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.319
	SRR3591707	mature leaf	3.637
	SRR3591708	Shoot apex	0.128
	SRR3591709	Stem	0.286
	SRR3591710	White floral bud	3.634
	SRR3591711	White flower	0.610
	SRR3591712	Green floral bud	2.163
	SRR3591713	Yellow flower	0.537
SRP173429	SRR8316895	Juvenile bud stage	0.266
	SRR8316896	Juvenile bud stage	0.840
	SRR8316897	Juvenile bud stage	0.810
	SRR8316894	Third green stage	0.366
	SRR8316900	Third green stage	0.976
	SRR8316901	Third green stage	1.095
	SRR8316898	Complete white stage	2.793
	SRR8316899	Complete white stage	2.841
	SRR8316903	Complete white stage	1.661
	SRR8316902	Silver flowering stage	1.006
	SRR8316904	Silver flowering stage	0.969
	SRR8316905	Silver flowering stage	0.929
	SRR8316906	Gold flowering stage	4.734
	SRR8316907	Gold flowering stage	1.330
	SRR8316908	Gold flowering stage	4.191
SRP132670	SRR6706286	Control	5.478
	SRR6706287	Light intensity 50%	3.962
	SRR6706288	Light intensity 20%	2.824
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.151
	CNS0095594	Slightly white alabastrum(diploid) 3	0.292
	CNS0095595	Whole white alabastrum(diploid) 2	0.123
	CNS0095596	Whole white alabastrum(diploid) 3	0.108
	CNS0095597	Whole white alabastrum(diploid) 4	0.067
	CNS0095598	Silvery flower (diploied) 1	0.038
	CNS0095599	Silvery flower (diploied) 2	0.028
	CNS0095600	Silvery flower (diploied) 3	2.132
	CNS0095601	Golden flower (diploid) 1	0.447
	CNS0095602	Golden flower (diploid) 2	0.426
	CNS0095603	Golden flower (diploid) 3	0.530
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.188
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.421
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.064
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.028
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.155
	CNS0095610	Silvery flower (tetraploid) 1	0.610
	CNS0095611	Silvery flower (tetraploid) 2	0.025
	CNS0095612	Silvery flower (tetraploid) 3	0.578
	CNS0095613	Golden flower (tetraploid) 1	0.988
	CNS0095614	Golden flower (tetraploid) 2	4.011
	CNS0095615	Golden flower (tetraploid) 3	0.045
CRA001975	CRR073297	Stem 1	0.096
	CRR073298	Stem 2	0.274
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.088
	CRR073301	Leaf 2	0.287
	CRR073302	Leaf 3	0.042
	CRR073303	Juvenile bud 1	0.111
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.007
	CRR073306	Third green 1	0.375
	CRR073307	Third green 2	0.040
	CRR073308	Third green 3	0.081
	CRR073309	Second white 1	0.735
	CRR073310	Second white 2	0.259
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.355
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	1.707
	CRR073318	Tawny withering 1	5.242
	CRR073319	Tawny withering 2	7.476
	CRR073320	Tawny withering 3	0.490