Gene detail

Detail information of GWHGAAZE033237

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP20056.1	1.1228E-63	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9LEQ3\|CNG18_ARATH	3E-48	Putative cyclic nucleotide-gated ion channel 18
trEMBL	tr\|A0A068VH72\|A0A068VH72_COFCA	4E-64	Coffea canephora DH200=94 genomic scaffold, scaffold_865 {ECO:0000313\|EMBL:CDP20056.1}
TAIR10	AT5G14870.1	4E-42	cyclic nucleotide-gated channel 18

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000094	gene	3372088	3372558	+
GWHAAZE00000094	mRNA	3372088	3372558	+
GWHAAZE00000094	exon	3372088	3372558	+
GWHAAZE00000094	CDS	3372088	3372558	+

Transcript Sequence
>GWHTAAZE033276 ATGGATAGAATATTCAGCAGGCCGGCGTCTCATCTCCGCCACTTTCGCCGACCATCTCAACCAATAATCCCAGGCCAACACACCAACAGCATTATATGGAGCCACCAGATTCTAGATCCCGACGGCGATATCGTCAGCAAATGGAACCACGTCTTCCTCATCACCACCTTAATCTCTCTCTTTATAGATCCTCTCTATTTCTATCTCCCTTACGTAGAGGGAGATCACTCCTGTATGAGAACAGATAATGATTCGTCTGTCGCTATTACCTCTGTTAGATCCATTTTTGATCTTTTTTATGCGTTCAATATACTTGTTAAGTTTCGGACCGCGTTTGTGGCACCGAGTTCTAGGGTTTTCGGTAGGGGAGAACTAATTATGGATGCCAACCAGATCGCAAATCGCTACTTGAAGTCTGATTTCATTATTGACCTTGCCGCCATGCTTCCATTACCGCAGGCAAGCAATTAA

Network for GWHGAAZE033237

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00520.32	Ion_trans	48	153	2.30E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05391	CNGC	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0006811	biological_process	ion transport
GO:0055085	biological_process	transmembrane transport
GO:0016020	cellular_component	membrane
GO:0005216	molecular_function	ion channel activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.296
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.385
	SRR3591709	Stem	0.246
	SRR3591710	White floral bud	88.029
	SRR3591711	White flower	4.718
	SRR3591712	Green floral bud	52.132
	SRR3591713	Yellow flower	1.913
SRP173429	SRR8316895	Juvenile bud stage	1.531
	SRR8316896	Juvenile bud stage	9.591
	SRR8316897	Juvenile bud stage	7.751
	SRR8316894	Third green stage	4.625
	SRR8316900	Third green stage	24.912
	SRR8316901	Third green stage	21.833
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.262
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.616
	SRR8316904	Silver flowering stage	1.915
	SRR8316905	Silver flowering stage	0.737
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.250
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	29.389
	SRR6706287	Light intensity 50%	31.040
	SRR6706288	Light intensity 20%	24.727
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.261
	CNS0095593	Slightly white alabastrum(diploid) 2	9.906
	CNS0095594	Slightly white alabastrum(diploid) 3	8.668
	CNS0095595	Whole white alabastrum(diploid) 2	34.647
	CNS0095596	Whole white alabastrum(diploid) 3	39.722
	CNS0095597	Whole white alabastrum(diploid) 4	58.803
	CNS0095598	Silvery flower (diploied) 1	2.371
	CNS0095599	Silvery flower (diploied) 2	7.835
	CNS0095600	Silvery flower (diploied) 3	3.487
	CNS0095601	Golden flower (diploid) 1	2.112
	CNS0095602	Golden flower (diploid) 2	4.394
	CNS0095603	Golden flower (diploid) 3	2.517
	CNS0095604	Slightly white alabastrum(tetraploid) 1	31.861
	CNS0095605	Slightly white alabastrum(tetraploid) 2	26.884
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.147
	CNS0095607	Whole white alabastrum(tetraploid) 1	72.644
	CNS0095608	Whole white alabastrum(tetraploid) 2	90.223
	CNS0095609	Whole white alabastrum(tetraploid) 3	46.048
	CNS0095610	Silvery flower (tetraploid) 1	1.249
	CNS0095611	Silvery flower (tetraploid) 2	10.790
	CNS0095612	Silvery flower (tetraploid) 3	18.188
	CNS0095613	Golden flower (tetraploid) 1	0.849
	CNS0095614	Golden flower (tetraploid) 2	0.525
	CNS0095615	Golden flower (tetraploid) 3	10.017
CRA001975	CRR073297	Stem 1	4.883
	CRR073298	Stem 2	7.514
	CRR073299	Stem 3	2.872
	CRR073300	Leaf 1	36.731
	CRR073301	Leaf 2	21.739
	CRR073302	Leaf 3	7.894
	CRR073303	Juvenile bud 1	29.437
	CRR073304	Juvenile bud 2	19.792
	CRR073305	Juvenile bud 3	2.471
	CRR073306	Third green 1	18.918
	CRR073307	Third green 2	19.166
	CRR073308	Third green 3	15.354
	CRR073309	Second white 1	0.548
	CRR073310	Second white 2	3.135
	CRR073311	Second white 3	2.555
	CRR073312	Silver flowering 1	16.184
	CRR073313	Silver flowering 2	20.065
	CRR073314	Silver flowering 3	11.475
	CRR073315	Gold flowering 1	13.979
	CRR073316	Gold flowering 2	5.696
	CRR073317	Gold flowering 3	5.999
	CRR073318	Tawny withering 1	16.878
	CRR073319	Tawny withering 2	17.615
	CRR073320	Tawny withering 3	15.066