Gene detail

Detail information of GWHGAAZE033260

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP02096.1	2.4672E-113	unnamed protein product [Coffea canephora]
Swissprot	tr\|P81391\|MYB05_ANTMA	4E-102	Myb-related protein 305
trEMBL	tr\|A0A068U0Q2\|A0A068U0Q2_COFCA	9E-114	Coffea canephora DH200=94 genomic scaffold, scaffold_8 {ECO:0000313\|EMBL:CDP02096.1}
TAIR10	AT3G27810.1	2E-68	myb domain protein 21

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000094	gene	3690696	3693560	-
GWHAAZE00000094	mRNA	3690696	3693560	-
GWHAAZE00000094	exon	3690696	3691014	-
GWHAAZE00000094	exon	3693213	3693342	-
GWHAAZE00000094	exon	3693425	3693560	-
GWHAAZE00000094	CDS	3693425	3693560	-
GWHAAZE00000094	CDS	3693213	3693342	-
GWHAAZE00000094	CDS	3690696	3691014	-

Transcript Sequence
>GWHTAAZE033299 ATGGATAAGAAACCATGCAACTCACAAGAGGTTGAAGTGAGGAAAGGGCCATGGACTATGGAAGAAGACTTGATCTTGATCAACTATATCGCGAATCACGGTGAAGGTGTATGGAACTCACTAGCCCGATCTGCTGGTCTCAAGCGTACTGGAAAAAGTTGTCGGCTCCGGTGGCTTAACTACCTCCGGCCGGATGTAAGGAGAGGTAATATTACACCGGAGGAGCAACTCTTAATCATGGAACTTCATGCTAAGTGGGGAAACAGGTGGTCAAAAATTGCAAAACATTTACCTGGAAGAACCGACAATGAAATAAAGAACTACTGGAGAACGAGAATCCAAAAGCATATCAAACAAGCCGAAAATTTCAACGGACAAAGCAGTGCTGAGCGTAATAACATTAATGATCAAGCAAACACAAGCCATGCGACTGGCACTATCGCGGACGCGGTGGAAACTTACTCTCCACAGTCGTACCCAGGAAATATGGAGATGTTTCCGGTTCCTAATTTTTCCACTGAATCACATGACAACATTTGGAGCATGGATGATCTCTGGTCTATGCAGTTACTTAATAGCGATTAA

Network for GWHGAAZE033260

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00249.32	Myb_DNA-binding	15	62	1.20E-14
PF00249.32	Myb_DNA-binding	68	111	6.80E-16

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MYB

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.545
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.513
	SRR3591709	Stem	1.132
	SRR3591710	White floral bud	1467.230
	SRR3591711	White flower	1190.036
	SRR3591712	Green floral bud	1.539
	SRR3591713	Yellow flower	734.812
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.128
	SRR8316901	Third green stage	0.068
	SRR8316898	Complete white stage	731.394
	SRR8316899	Complete white stage	3.283
	SRR8316903	Complete white stage	1075.911
	SRR8316902	Silver flowering stage	454.041
	SRR8316904	Silver flowering stage	636.449
	SRR8316905	Silver flowering stage	327.175
	SRR8316906	Gold flowering stage	516.062
	SRR8316907	Gold flowering stage	609.484
	SRR8316908	Gold flowering stage	627.093
SRP132670	SRR6706286	Control	46.372
	SRR6706287	Light intensity 50%	120.099
	SRR6706288	Light intensity 20%	0.177
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.250
	CNS0095593	Slightly white alabastrum(diploid) 2	1.325
	CNS0095594	Slightly white alabastrum(diploid) 3	0.964
	CNS0095595	Whole white alabastrum(diploid) 2	1.796
	CNS0095596	Whole white alabastrum(diploid) 3	1.084
	CNS0095597	Whole white alabastrum(diploid) 4	2.387
	CNS0095598	Silvery flower (diploied) 1	332.108
	CNS0095599	Silvery flower (diploied) 2	315.179
	CNS0095600	Silvery flower (diploied) 3	1126.459
	CNS0095601	Golden flower (diploid) 1	213.741
	CNS0095602	Golden flower (diploid) 2	598.449
	CNS0095603	Golden flower (diploid) 3	575.063
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.140
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.001
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.701
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.572
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.498
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.765
	CNS0095610	Silvery flower (tetraploid) 1	1087.388
	CNS0095611	Silvery flower (tetraploid) 2	1341.132
	CNS0095612	Silvery flower (tetraploid) 3	3002.769
	CNS0095613	Golden flower (tetraploid) 1	1643.121
	CNS0095614	Golden flower (tetraploid) 2	872.636
	CNS0095615	Golden flower (tetraploid) 3	1316.424
CRA001975	CRR073297	Stem 1	1.071
	CRR073298	Stem 2	0.598
	CRR073299	Stem 3	0.502
	CRR073300	Leaf 1	0.528
	CRR073301	Leaf 2	1.010
	CRR073302	Leaf 3	1.459
	CRR073303	Juvenile bud 1	5.177
	CRR073304	Juvenile bud 2	23.408
	CRR073305	Juvenile bud 3	0.784
	CRR073306	Third green 1	1556.688
	CRR073307	Third green 2	1540.909
	CRR073308	Third green 3	1507.229
	CRR073309	Second white 1	697.433
	CRR073310	Second white 2	906.341
	CRR073311	Second white 3	536.714
	CRR073312	Silver flowering 1	436.264
	CRR073313	Silver flowering 2	338.629
	CRR073314	Silver flowering 3	460.918
	CRR073315	Gold flowering 1	0.847
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.096
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.114
	CRR073320	Tawny withering 3	0.036