Gene detail

Detail information of GWHGAAZE033387

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006584165.1	6.39826E-43	PREDICTED: protein TOPLESS-like [Glycine max]
COG	YP_004909221.1	0.0000006	hypothetical protein KSE_75110
Swissprot	tr\|Q0WV90\|TPR1_ARATH	1E-34	Topless-related protein 1
trEMBL	tr\|A0A059CNK0\|A0A059CNK0_EUCGR	4E-43	Uncharacterized protein {ECO:0000313\|EMBL:KCW80023.1}
TAIR10	AT1G80490.1	3E-31	TOPLESS-related 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000093	gene	28877	30224	-
GWHAAZE00000093	mRNA	28877	30224	-
GWHAAZE00000093	exon	28877	28990	-
GWHAAZE00000093	exon	29440	29535	-
GWHAAZE00000093	exon	29656	29751	-
GWHAAZE00000093	exon	29852	29928	-
GWHAAZE00000093	exon	30028	30101	-
GWHAAZE00000093	exon	30187	30224	-
GWHAAZE00000093	CDS	30187	30224	-
GWHAAZE00000093	CDS	30028	30101	-
GWHAAZE00000093	CDS	29852	29928	-
GWHAAZE00000093	CDS	29656	29751	-
GWHAAZE00000093	CDS	29440	29535	-
GWHAAZE00000093	CDS	28877	28990	-

Transcript Sequence
>GWHTAAZE033426 ATGCTGAATTTGAACAAAATTCTACAACTTGTCACCAAGAGGTTTTGGTCGAAGATCAATGTATCCAAGTTAACCGTATATTATAGAGCCCAGATGGTTCTCTCTTTGGAAAGGGTTGCGTATTCAAAACACATTGTGCATTTATATTCCTACCATAGTGACGACAATAATATTGATATTCAATTAGAGATTGAAGCTCATGTTGGCGGTGTCAATGATCTTGCATTATCCAAACCAAATGAGCAACTTTATGTCATAACGTGCGGTTATGACAAGTTTATCAGGGTGTGGGATGTCACTACCGGTGTCAAGCAATATGTTTTTGAAGGTCACGAGGCCCCAATTTATTCAATATGCTCTCATGTGAGCAACGGAATTCATTTTGGCACAAGCAAGAATAAGTTTTTGGCTGTTGGTGATGAACATTTAATCAAAGTTTGGGATATGAATAATGTTGAACTTCTTGCAACTATTGATGCAGATGGAGAATTGGTC

Network for GWHGAAZE033387

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00400.33	WD40	62	98	0.001
PF00400.33	WD40	104	148	0.0051

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	DWD

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.399
	SRR3591711	White flower	0.115
	SRR3591712	Green floral bud	0.209
	SRR3591713	Yellow flower	0.051
SRP173429	SRR8316895	Juvenile bud stage	0.183
	SRR8316896	Juvenile bud stage	0.061
	SRR8316897	Juvenile bud stage	0.060
	SRR8316894	Third green stage	0.105
	SRR8316900	Third green stage	0.121
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.269
	SRR8316903	Complete white stage	0.034
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.049
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.045
	SRR8316907	Gold flowering stage	0.085
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.001
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.532
	CNS0095593	Slightly white alabastrum(diploid) 2	1.254
	CNS0095594	Slightly white alabastrum(diploid) 3	2.186
	CNS0095595	Whole white alabastrum(diploid) 2	2.030
	CNS0095596	Whole white alabastrum(diploid) 3	1.430
	CNS0095597	Whole white alabastrum(diploid) 4	0.696
	CNS0095598	Silvery flower (diploied) 1	1.499
	CNS0095599	Silvery flower (diploied) 2	0.526
	CNS0095600	Silvery flower (diploied) 3	0.130
	CNS0095601	Golden flower (diploid) 1	0.731
	CNS0095602	Golden flower (diploid) 2	0.221
	CNS0095603	Golden flower (diploid) 3	0.257
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.315
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.069
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.409
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.269
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.231
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.026
	CNS0095610	Silvery flower (tetraploid) 1	0.106
	CNS0095611	Silvery flower (tetraploid) 2	0.119
	CNS0095612	Silvery flower (tetraploid) 3	0.042
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.021
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.151
	CRR073298	Stem 2	0.043
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.098
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.023
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000