Gene detail

Detail information of GWHGAAZE033491

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008227395.1	3.62909E-54	PREDICTED: polygalacturonase-like [Prunus mume]
COG	YP_001540068.1	0.000002	glycoside hydrolase
Swissprot	tr\|P48979\|PGLR_PRUPE	2E-51	Polygalacturonase (Precursor)
trEMBL	tr\|W9RN73\|W9RN73_9ROSA	4E-53	Uncharacterized protein {ECO:0000313\|EMBL:EXB88290.1}
TAIR10	AT2G43870.1	6E-43	Pectin lyase-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000104	gene	1067316	1068303	-
GWHAAZE00000104	mRNA	1067316	1068303	-
GWHAAZE00000104	exon	1067316	1067579	-
GWHAAZE00000104	exon	1067896	1068303	-
GWHAAZE00000104	CDS	1067896	1068303	-
GWHAAZE00000104	CDS	1067316	1067579	-

Transcript Sequence
>GWHTAAZE033530 ATGTTGATGTCTAAGGCTAGTAATAGTGTACTTCTTGTTACACTTGCAGTGTTGATGTTCTTCAATGTCATTTCATCATCACTACCAAATAAAACTTTCAATGTGATCGATTTAGGAGCTGATCCAGATGGGAAAACTGATTCGACCAATGCCTTCCTTGACGCTTGGGAGTTGTCAAGTCGCGAGGAATTTCCAAACTTGATCTACGTGCCCCCGGGCACGTATGTGGTTCAGAAAATGAACTTGACCGGGCATGATAACAATCCTCTTGTCACCTTTGGAATCAATGGAACATTGTCGGCTCCATGGGACTATAGGGATACCGGAGAAGTCGAAAACTGGATCACATTTAATGATGTTAACAATGTCAGAATTGAGGGCGGAATACTGGACGGGCATGGTGCTACGACGCTGGGATTTTTCGGTTCCAATGTTATCGAGATAAGCGGGTTAACATCGTTAAACAGCAAAATGTTTCACATTGTGATCAATGGGTGCCACAGGGTGACATTAGATGGAGTAAAGGTCTTGGCTTCAGGCAGTCCAAATGCATATGGCCTTCACTTACACTCATCATCTGAAGTGAATATAAGCTCATATACTAATAATCTCTGTGGTAGGGGAGAGAATTGTGTCTCAATAGGCGGAGGCTTTACTGATTTATACCTCTAA

Network for GWHGAAZE033491

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0095

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF12708.8	Pectate_lyase_3	33	81	8.30E-11
PF00295.18	Glyco_hydro_28	144	217	1.30E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01184	E3.2.1.15	Metabolic pathways	map01100
K01184	E3.2.1.15	Pentose and glucuronate interconversions	map00040

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0004650	molecular_function	polygalacturonase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.726
	SRR3591706	second leaf	16.463
	SRR3591707	mature leaf	7.636
	SRR3591708	Shoot apex	5.168
	SRR3591709	Stem	0.939
	SRR3591710	White floral bud	105.699
	SRR3591711	White flower	61.026
	SRR3591712	Green floral bud	6.378
	SRR3591713	Yellow flower	0.264
SRP173429	SRR8316895	Juvenile bud stage	59.709
	SRR8316896	Juvenile bud stage	4.718
	SRR8316897	Juvenile bud stage	0.634
	SRR8316894	Third green stage	19.261
	SRR8316900	Third green stage	8.068
	SRR8316901	Third green stage	7.199
	SRR8316898	Complete white stage	1.757
	SRR8316899	Complete white stage	137.423
	SRR8316903	Complete white stage	30.842
	SRR8316902	Silver flowering stage	0.925
	SRR8316904	Silver flowering stage	2.014
	SRR8316905	Silver flowering stage	1.228
	SRR8316906	Gold flowering stage	2.700
	SRR8316907	Gold flowering stage	1.470
	SRR8316908	Gold flowering stage	1.248
SRP132670	SRR6706286	Control	6.538
	SRR6706287	Light intensity 50%	11.386
	SRR6706288	Light intensity 20%	12.140
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	125.208
	CNS0095593	Slightly white alabastrum(diploid) 2	46.031
	CNS0095594	Slightly white alabastrum(diploid) 3	51.151
	CNS0095595	Whole white alabastrum(diploid) 2	87.672
	CNS0095596	Whole white alabastrum(diploid) 3	13.832
	CNS0095597	Whole white alabastrum(diploid) 4	51.540
	CNS0095598	Silvery flower (diploied) 1	107.086
	CNS0095599	Silvery flower (diploied) 2	46.220
	CNS0095600	Silvery flower (diploied) 3	71.007
	CNS0095601	Golden flower (diploid) 1	110.903
	CNS0095602	Golden flower (diploid) 2	104.158
	CNS0095603	Golden flower (diploid) 3	101.723
	CNS0095604	Slightly white alabastrum(tetraploid) 1	151.854
	CNS0095605	Slightly white alabastrum(tetraploid) 2	108.651
	CNS0095606	Slightly white alabastrum(tetraploid) 3	248.739
	CNS0095607	Whole white alabastrum(tetraploid) 1	60.261
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.864
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.537
	CNS0095610	Silvery flower (tetraploid) 1	1.750
	CNS0095611	Silvery flower (tetraploid) 2	63.691
	CNS0095612	Silvery flower (tetraploid) 3	5.250
	CNS0095613	Golden flower (tetraploid) 1	0.504
	CNS0095614	Golden flower (tetraploid) 2	0.294
	CNS0095615	Golden flower (tetraploid) 3	0.245
CRA001975	CRR073297	Stem 1	5.125
	CRR073298	Stem 2	5.178
	CRR073299	Stem 3	3.921
	CRR073300	Leaf 1	8.116
	CRR073301	Leaf 2	9.383
	CRR073302	Leaf 3	3.516
	CRR073303	Juvenile bud 1	4.131
	CRR073304	Juvenile bud 2	4.310
	CRR073305	Juvenile bud 3	3.631
	CRR073306	Third green 1	1.127
	CRR073307	Third green 2	0.399
	CRR073308	Third green 3	0.478
	CRR073309	Second white 1	0.449
	CRR073310	Second white 2	0.816
	CRR073311	Second white 3	0.571
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.423
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.909
	CRR073316	Gold flowering 2	1.389
	CRR073317	Gold flowering 3	1.993
	CRR073318	Tawny withering 1	2.132
	CRR073319	Tawny withering 2	6.205
	CRR073320	Tawny withering 3	1.269