Gene detail

Detail information of GWHGAAZE033518

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010927913.1	9.0249E-112	PREDICTED: 60S ribosomal protein L5-like isoform X2 [Elaeis guineensis]
COG	YP_503658.1	3E-22	50S ribosomal protein L18
Swissprot	tr\|Q6UNT2\|RL5_CUCSA	2E-108	60S ribosomal protein L5
trEMBL	tr\|M0RFA0\|M0RFA0_MUSAM	2E-110	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GSMUA_Achr10P04230_001}
TAIR10	AT5G39740.2	2E-85	ribosomal protein L5 B

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000104	gene	1415402	1419832	-
GWHAAZE00000104	mRNA	1415402	1419832	-
GWHAAZE00000104	exon	1419761	1419832	-
GWHAAZE00000104	exon	1418136	1418205	-
GWHAAZE00000104	exon	1417960	1418051	-
GWHAAZE00000104	exon	1417523	1417649	-
GWHAAZE00000104	exon	1417368	1417447	-
GWHAAZE00000104	exon	1417161	1417277	-
GWHAAZE00000104	exon	1415402	1415494	-
GWHAAZE00000104	CDS	1419761	1419832	-
GWHAAZE00000104	CDS	1418136	1418205	-
GWHAAZE00000104	CDS	1417960	1418051	-
GWHAAZE00000104	CDS	1417523	1417649	-
GWHAAZE00000104	CDS	1417368	1417447	-
GWHAAZE00000104	CDS	1417161	1417277	-
GWHAAZE00000104	CDS	1415402	1415494	-

Transcript Sequence
>GWHTAAZE033557 ATGCTAGGGTTTGATTATTGTTATACCTCTAGAATTGAGATCATTACGCTGAGCTTCGAGGCGATTGAGATCGCTTTTGTCAAATCCCAAACGACAAAGGCATACTTTAAGCGCTATCAGGTTAAGTTTAAGACAAGAAGGGAGGGGAAGACAGATTACAGGGCCAGGATTCTTCTAATTAACCAGGACAAGAACAAGTACAACACTCCAAAGTACCGCTCTGTTGTTCGATTTACAAACAAGGATATTATTGCACAAATAGTATCTGCCAGCATTGCTGGTGATATGGTTCATGCTGCAGCCTATGCCCACGAGCTTCCTCGATATGGGCTTGAAGTAGGTCTCACCAATTATGCAGCAGCTTACTGTACTGGACTTCTATTGGCCCGTCGTGTCTTGAAAATGCATGAGATGGATGACGAATATCAAGGCAATGTGGCGGCAACTGGAGAGGATTTCTCAGTTGAACCAGCAGAGAGTAGAAGACCATTCCGCGCACTCCTTGACATCGGCCTTATTAGAACAACTACTGGGAACCGTGTTTTTGGTGCTCTCAAGACTTTGATGGAAGATGAGCCAGAGAAGTACCAAAGTCACTTCTCTTTGTACATCAAGAAAGGAATTCAACCAGATGGTGTGGAGGCAATGTAA

Network for GWHGAAZE033518

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF17144.5	Ribosomal_L5e	37	189	1.50E-71
PF14204.7	Ribosomal_L18_c	178	216	4.20E-07

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02932	RP-L5e, RPL5	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome
GO:0008097	molecular_function	5S rRNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.297
	SRR3591706	second leaf	12.385
	SRR3591707	mature leaf	2.291
	SRR3591708	Shoot apex	11.486
	SRR3591709	Stem	3.743
	SRR3591710	White floral bud	9.752
	SRR3591711	White flower	6.004
	SRR3591712	Green floral bud	21.048
	SRR3591713	Yellow flower	3.402
SRP173429	SRR8316895	Juvenile bud stage	11.992
	SRR8316896	Juvenile bud stage	20.159
	SRR8316897	Juvenile bud stage	15.913
	SRR8316894	Third green stage	7.535
	SRR8316900	Third green stage	11.363
	SRR8316901	Third green stage	16.541
	SRR8316898	Complete white stage	1.422
	SRR8316899	Complete white stage	6.852
	SRR8316903	Complete white stage	2.788
	SRR8316902	Silver flowering stage	0.971
	SRR8316904	Silver flowering stage	1.899
	SRR8316905	Silver flowering stage	0.549
	SRR8316906	Gold flowering stage	1.165
	SRR8316907	Gold flowering stage	1.595
	SRR8316908	Gold flowering stage	1.376
SRP132670	SRR6706286	Control	20.438
	SRR6706287	Light intensity 50%	14.784
	SRR6706288	Light intensity 20%	21.249
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	13.517
	CNS0095593	Slightly white alabastrum(diploid) 2	15.638
	CNS0095594	Slightly white alabastrum(diploid) 3	10.446
	CNS0095595	Whole white alabastrum(diploid) 2	6.785
	CNS0095596	Whole white alabastrum(diploid) 3	8.024
	CNS0095597	Whole white alabastrum(diploid) 4	7.399
	CNS0095598	Silvery flower (diploied) 1	1.325
	CNS0095599	Silvery flower (diploied) 2	1.127
	CNS0095600	Silvery flower (diploied) 3	1.452
	CNS0095601	Golden flower (diploid) 1	3.176
	CNS0095602	Golden flower (diploid) 2	1.297
	CNS0095603	Golden flower (diploid) 3	0.392
	CNS0095604	Slightly white alabastrum(tetraploid) 1	24.057
	CNS0095605	Slightly white alabastrum(tetraploid) 2	16.586
	CNS0095606	Slightly white alabastrum(tetraploid) 3	27.084
	CNS0095607	Whole white alabastrum(tetraploid) 1	16.248
	CNS0095608	Whole white alabastrum(tetraploid) 2	11.737
	CNS0095609	Whole white alabastrum(tetraploid) 3	15.669
	CNS0095610	Silvery flower (tetraploid) 1	6.503
	CNS0095611	Silvery flower (tetraploid) 2	7.737
	CNS0095612	Silvery flower (tetraploid) 3	5.889
	CNS0095613	Golden flower (tetraploid) 1	3.805
	CNS0095614	Golden flower (tetraploid) 2	3.798
	CNS0095615	Golden flower (tetraploid) 3	1.941
CRA001975	CRR073297	Stem 1	26.845
	CRR073298	Stem 2	14.393
	CRR073299	Stem 3	3.885
	CRR073300	Leaf 1	19.798
	CRR073301	Leaf 2	20.248
	CRR073302	Leaf 3	3.766
	CRR073303	Juvenile bud 1	3.560
	CRR073304	Juvenile bud 2	1.311
	CRR073305	Juvenile bud 3	1.830
	CRR073306	Third green 1	0.317
	CRR073307	Third green 2	0.636
	CRR073308	Third green 3	0.177
	CRR073309	Second white 1	0.021
	CRR073310	Second white 2	0.103
	CRR073311	Second white 3	0.102
	CRR073312	Silver flowering 1	0.288
	CRR073313	Silver flowering 2	0.014
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.022
	CRR073316	Gold flowering 2	0.868
	CRR073317	Gold flowering 3	0.259
	CRR073318	Tawny withering 1	2.364
	CRR073319	Tawny withering 2	4.527
	CRR073320	Tawny withering 3	1.435