Gene detail

Detail information of GWHGAAZE033547

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011097530.1	4.68354E-50	PREDICTED: signal recognition particle receptor subunit alpha homolog [Sesamum indicum]
trEMBL	tr\|A0A0A0LK35\|A0A0A0LK35_CUCSA	1E-46	Uncharacterized protein {ECO:0000313\|EMBL:KGN61052.1}
TAIR10	AT4G30600.1	3E-30	signal recognition particle receptor alpha subunit family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000108	gene	1060169	1061659	-
GWHAAZE00000108	mRNA	1060169	1061659	-
GWHAAZE00000108	exon	1060169	1060213	-
GWHAAZE00000108	exon	1060322	1060417	-
GWHAAZE00000108	exon	1060608	1060679	-
GWHAAZE00000108	exon	1061450	1061659	-
GWHAAZE00000108	CDS	1061450	1061659	-
GWHAAZE00000108	CDS	1060608	1060679	-
GWHAAZE00000108	CDS	1060322	1060417	-
GWHAAZE00000108	CDS	1060169	1060213	-

Transcript Sequence
>GWHTAAZE033586 GAGGAACCAAGGAAAAAGATAACAAAGAAGAACAGAGTTTGGGATGATCACCTCGAGAGTCAAAAATTGGACTTTACAAACCCAACGAGTGAGAATGGGGAAGGGAATATGGTGGTGGTTGCTGCATATCAAGGTGAGAGTATGATGGACAAAGAGGAGATTTTTAGCAGTGATAGTGAAGAGGATGATGAAGCCGAGAAAGATAGAAAGGAAAATTTGGAGAAGGCAGATCTAGAACCAGCTTTGAAAGCTCTCAAGGATAGGCTCATGACCAATAATGTGGCTGATGAAATAGCTGAAAAACTTTGTGAATCAGTTGCAGCAAGTCTCGAGAGTAAAAAACATGCCTCATTCACAAGGATATCATCAACGATGCAAGCGGCAATGAAGAGGGTGCATCTTGACTCACAAACGCTCCATTGA

Network for GWHGAAZE033547

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04086.14	SRP-alpha_N	4	63	1.00E-10
PF02881.20	SRP54_N	70	119	7.80E-05

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13431	SRPR	Protein export	map03060

Gene Ontology

GO term	Ontology	Name
GO:0006886	biological_process	intracellular protein transport
GO:0005785	cellular_component	signal recognition particle receptor complex
GO:0003924	molecular_function	GTPase activity
GO:0005047	molecular_function	signal recognition particle binding
GO:0005525	molecular_function	GTP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.955
	SRR3591706	second leaf	3.211
	SRR3591707	mature leaf	2.132
	SRR3591708	Shoot apex	4.139
	SRR3591709	Stem	8.362
	SRR3591710	White floral bud	1.050
	SRR3591711	White flower	2.493
	SRR3591712	Green floral bud	1.674
	SRR3591713	Yellow flower	1.667
SRP173429	SRR8316895	Juvenile bud stage	0.661
	SRR8316896	Juvenile bud stage	0.755
	SRR8316897	Juvenile bud stage	2.252
	SRR8316894	Third green stage	0.233
	SRR8316900	Third green stage	0.650
	SRR8316901	Third green stage	1.800
	SRR8316898	Complete white stage	0.202
	SRR8316899	Complete white stage	0.684
	SRR8316903	Complete white stage	0.390
	SRR8316902	Silver flowering stage	0.168
	SRR8316904	Silver flowering stage	0.949
	SRR8316905	Silver flowering stage	0.035
	SRR8316906	Gold flowering stage	0.699
	SRR8316907	Gold flowering stage	0.921
	SRR8316908	Gold flowering stage	1.391
SRP132670	SRR6706286	Control	0.481
	SRR6706287	Light intensity 50%	0.396
	SRR6706288	Light intensity 20%	0.625
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.877
	CNS0095593	Slightly white alabastrum(diploid) 2	0.566
	CNS0095594	Slightly white alabastrum(diploid) 3	0.388
	CNS0095595	Whole white alabastrum(diploid) 2	0.526
	CNS0095596	Whole white alabastrum(diploid) 3	1.346
	CNS0095597	Whole white alabastrum(diploid) 4	1.738
	CNS0095598	Silvery flower (diploied) 1	1.313
	CNS0095599	Silvery flower (diploied) 2	0.787
	CNS0095600	Silvery flower (diploied) 3	2.621
	CNS0095601	Golden flower (diploid) 1	0.259
	CNS0095602	Golden flower (diploid) 2	1.783
	CNS0095603	Golden flower (diploid) 3	1.163
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.559
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.361
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.372
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.044
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.072
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.249
	CNS0095610	Silvery flower (tetraploid) 1	5.565
	CNS0095611	Silvery flower (tetraploid) 2	4.781
	CNS0095612	Silvery flower (tetraploid) 3	3.525
	CNS0095613	Golden flower (tetraploid) 1	3.979
	CNS0095614	Golden flower (tetraploid) 2	3.642
	CNS0095615	Golden flower (tetraploid) 3	1.722
CRA001975	CRR073297	Stem 1	1.891
	CRR073298	Stem 2	1.597
	CRR073299	Stem 3	0.095
	CRR073300	Leaf 1	2.470
	CRR073301	Leaf 2	1.035
	CRR073302	Leaf 3	0.809
	CRR073303	Juvenile bud 1	0.527
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.267
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.474
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.030
	CRR073311	Second white 3	0.072
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.102
	CRR073316	Gold flowering 2	0.481
	CRR073317	Gold flowering 3	0.373
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.534
	CRR073320	Tawny withering 3	0.000