Gene detail

Detail information of GWHGAAZE033639

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD31216.1	0	RNA polymerase alpha subunit protein (chloroplast) [Lonicera japonica]
COG	YP_007126701.1	7E-48	DNA-directed RNA polymerase subunit alpha
Swissprot	tr\|Q68RX5\|RPOA_PANGI	0	DNA-directed RNA polymerase subunit alpha {ECO:0000255\|HAMAP-Rule:MF_00059}
trEMBL	tr\|D3WBT4\|D3WBT4_LONJA	0	RNA polymerase alpha subunit protein {ECO:0000313\|EMBL:ADD31216.1}
TAIR10	ATCG00740.1	3E-126	RNA polymerase subunit alpha

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000106	gene	7034	7828	-
GWHAAZE00000106	mRNA	7034	7828	-
GWHAAZE00000106	exon	7034	7828	-
GWHAAZE00000106	CDS	7034	7828	-

Transcript Sequence
>GWHTAAZE033678 ATGGTTCAAGAGAAAGTAACAGTATCTACTCGGACACTAGAGTGGAAGTGCGTTGAATCAAGAGCAGACAGTAAGCGTCTTTATTATGGACGCTTTATTCTGTCTCCACTTATGAAAGGTCAAGCTGACACAATAGGCATTGCGATGCGAAGAGCTTTGCTTGGAGAAATAGAAGGAACATGCATCACACGCGCAAAATCTGAGAAAATACCACATGAATATTCTACCATAGTGGGTATTCAAGAATCAGTACATGAAATTTTAATGAATTTGAAAGAAATTGTATTGAGAAGTAATCTATATGGAACCTGCGACGCGTCCATTTGTGTCAGGGGTCCCGGAAATGTAACTGCTCAAGATATCATCTCACCGCCCTATGTCGAAATCATTGATAATACACAGCATATAGTTAGCTTGACGGAACCAATTGATTTTTGTATTGGATTACAAATCGAGAGGAATCGTGGATATCTTATAAAAACGCCAAATCATTTTCAAGATGGAAGTTATCCCATAGATGCTGTATTCATGCCTGTTCGAAATGCGAATCATAGTATTCATTCTTATGGGAATGAGAATGAGAAACAAGAAATACTCTTTCTCGAAATATGGACAAACGGAAGTTTAACTCCTAAAGAAGCACTTCATGAAGCCTCTCGGAATTTGATTGATTTATTTATTCCTTTTTTACATACAGAAGAAGAAAATTTACATTTAGAGGACAATCAACACACGGTTCCTTTAACCCCCTTTACCTTTCATGAGAAATTGGCTAAACTAAGAAAAAAAAAATAG

Network for GWHGAAZE033639

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0053
CFinderModule0205

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01193.25	RNA_pol_L	35	225	3.50E-12
PF01000.27	RNA_pol_A_bac	66	157	1.10E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03040	rpoA	RNA polymerase	map03020

Gene Ontology

GO term	Ontology	Name
GO:0006351	biological_process	transcription, DNA-templated
GO:0046983	molecular_function	protein dimerization activity
GO:0003899	molecular_function	DNA-directed 5'-3' RNA polymerase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.770
	SRR3591706	second leaf	0.556
	SRR3591707	mature leaf	1.183
	SRR3591708	Shoot apex	0.938
	SRR3591709	Stem	0.373
	SRR3591710	White floral bud	0.344
	SRR3591711	White flower	0.300
	SRR3591712	Green floral bud	0.450
	SRR3591713	Yellow flower	0.496
SRP173429	SRR8316895	Juvenile bud stage	5.250
	SRR8316896	Juvenile bud stage	2.754
	SRR8316897	Juvenile bud stage	7.956
	SRR8316894	Third green stage	8.481
	SRR8316900	Third green stage	1.603
	SRR8316901	Third green stage	0.747
	SRR8316898	Complete white stage	1.438
	SRR8316899	Complete white stage	0.750
	SRR8316903	Complete white stage	1.427
	SRR8316902	Silver flowering stage	2.854
	SRR8316904	Silver flowering stage	3.211
	SRR8316905	Silver flowering stage	3.137
	SRR8316906	Gold flowering stage	0.886
	SRR8316907	Gold flowering stage	0.583
	SRR8316908	Gold flowering stage	0.636
SRP132670	SRR6706286	Control	0.367
	SRR6706287	Light intensity 50%	0.364
	SRR6706288	Light intensity 20%	0.534
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.397
	CNS0095593	Slightly white alabastrum(diploid) 2	3.436
	CNS0095594	Slightly white alabastrum(diploid) 3	3.819
	CNS0095595	Whole white alabastrum(diploid) 2	5.783
	CNS0095596	Whole white alabastrum(diploid) 3	3.884
	CNS0095597	Whole white alabastrum(diploid) 4	6.860
	CNS0095598	Silvery flower (diploied) 1	4.209
	CNS0095599	Silvery flower (diploied) 2	3.285
	CNS0095600	Silvery flower (diploied) 3	2.998
	CNS0095601	Golden flower (diploid) 1	4.373
	CNS0095602	Golden flower (diploid) 2	2.440
	CNS0095603	Golden flower (diploid) 3	2.434
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.043
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.626
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.522
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.633
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.833
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.185
	CNS0095610	Silvery flower (tetraploid) 1	2.494
	CNS0095611	Silvery flower (tetraploid) 2	3.387
	CNS0095612	Silvery flower (tetraploid) 3	2.441
	CNS0095613	Golden flower (tetraploid) 1	2.463
	CNS0095614	Golden flower (tetraploid) 2	2.171
	CNS0095615	Golden flower (tetraploid) 3	3.068
CRA001975	CRR073297	Stem 1	2.392
	CRR073298	Stem 2	4.301
	CRR073299	Stem 3	1.497
	CRR073300	Leaf 1	1.895
	CRR073301	Leaf 2	2.505
	CRR073302	Leaf 3	1.562
	CRR073303	Juvenile bud 1	1.598
	CRR073304	Juvenile bud 2	1.278
	CRR073305	Juvenile bud 3	2.177
	CRR073306	Third green 1	1.388
	CRR073307	Third green 2	0.774
	CRR073308	Third green 3	1.731
	CRR073309	Second white 1	1.023
	CRR073310	Second white 2	4.413
	CRR073311	Second white 3	6.202
	CRR073312	Silver flowering 1	3.420
	CRR073313	Silver flowering 2	0.313
	CRR073314	Silver flowering 3	2.048
	CRR073315	Gold flowering 1	3.831
	CRR073316	Gold flowering 2	5.675
	CRR073317	Gold flowering 3	3.270
	CRR073318	Tawny withering 1	1.450
	CRR073319	Tawny withering 2	1.368
	CRR073320	Tawny withering 3	1.442