Gene detail

Detail information of GWHGAAZE033640

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD30128.1	4.72888E-81	ribosomal protein S11 (chloroplast) [Lonicera japonica]
COG	YP_001515605.1	8E-39	30S ribosomal protein S11
Swissprot	tr\|Q68RX4\|RR11_PANGI	4E-74	30S ribosomal protein S11, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_01310}
trEMBL	tr\|D3WBT8\|D3WBT8_LONJA	2E-81	30S ribosomal protein S11, chloroplastic {ECO:0000256\|HAMAP-Rule:MF_01310}
TAIR10	ATCG00750.1	2E-45	ribosomal protein S11

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000106	gene	7937	8317	-
GWHAAZE00000106	mRNA	7937	8317	-
GWHAAZE00000106	exon	7937	8317	-
GWHAAZE00000106	CDS	7937	8317	-

Transcript Sequence
>GWHTAAZE033679 ATGGCAAAAGCTATACCGAGAATTGGTTCACATAGGAAGGGACGTTTTGGTTCACGTAAGAGTACACGCCGAATACCAAAGGGAGTTATTCATGTTCAAGCAAGTTTCCATAATACCATTGTGACTGTTACAGATGTACGGGGTCAAGTAGTTTCTTGGTCCTCTGCCGGTACTTGTGGATTCAGAGGTAGAAGAAGAGGGACACCGTTTGCTGCTCAAACCATAGCAGGAAATGCGATTCGTACAGTAGTAGATCAAGGTATGAAACGAGCCAACGTCATGATAAAGGGTCCTGGTCTCGGAAGAGACGCAGCATTGCGAGCTATTCGCAGAAGCGGCATACTATTAACTTTCATACGTGATGTAACCCCCTCCACATAA

Network for GWHGAAZE033640

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00411.20	Ribosomal_S11	28	124	5.70E-40

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02948	RP-S11, MRPS11, rpsK	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.511
	SRR3591706	second leaf	0.626
	SRR3591707	mature leaf	0.511
	SRR3591708	Shoot apex	1.206
	SRR3591709	Stem	0.472
	SRR3591710	White floral bud	0.343
	SRR3591711	White flower	0.217
	SRR3591712	Green floral bud	0.506
	SRR3591713	Yellow flower	0.354
SRP173429	SRR8316895	Juvenile bud stage	4.910
	SRR8316896	Juvenile bud stage	2.962
	SRR8316897	Juvenile bud stage	6.091
	SRR8316894	Third green stage	6.721
	SRR8316900	Third green stage	1.160
	SRR8316901	Third green stage	0.966
	SRR8316898	Complete white stage	1.488
	SRR8316899	Complete white stage	0.363
	SRR8316903	Complete white stage	1.095
	SRR8316902	Silver flowering stage	2.132
	SRR8316904	Silver flowering stage	3.406
	SRR8316905	Silver flowering stage	2.540
	SRR8316906	Gold flowering stage	0.554
	SRR8316907	Gold flowering stage	0.312
	SRR8316908	Gold flowering stage	0.635
SRP132670	SRR6706286	Control	0.318
	SRR6706287	Light intensity 50%	0.459
	SRR6706288	Light intensity 20%	0.117
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.747
	CNS0095593	Slightly white alabastrum(diploid) 2	5.509
	CNS0095594	Slightly white alabastrum(diploid) 3	4.258
	CNS0095595	Whole white alabastrum(diploid) 2	5.609
	CNS0095596	Whole white alabastrum(diploid) 3	6.051
	CNS0095597	Whole white alabastrum(diploid) 4	7.325
	CNS0095598	Silvery flower (diploied) 1	3.725
	CNS0095599	Silvery flower (diploied) 2	2.255
	CNS0095600	Silvery flower (diploied) 3	2.651
	CNS0095601	Golden flower (diploid) 1	3.185
	CNS0095602	Golden flower (diploid) 2	2.805
	CNS0095603	Golden flower (diploid) 3	1.883
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.776
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.642
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.584
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.255
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.796
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.451
	CNS0095610	Silvery flower (tetraploid) 1	1.876
	CNS0095611	Silvery flower (tetraploid) 2	4.121
	CNS0095612	Silvery flower (tetraploid) 3	2.432
	CNS0095613	Golden flower (tetraploid) 1	2.681
	CNS0095614	Golden flower (tetraploid) 2	2.805
	CNS0095615	Golden flower (tetraploid) 3	2.004
CRA001975	CRR073297	Stem 1	8.780
	CRR073298	Stem 2	9.877
	CRR073299	Stem 3	5.152
	CRR073300	Leaf 1	7.586
	CRR073301	Leaf 2	7.874
	CRR073302	Leaf 3	3.620
	CRR073303	Juvenile bud 1	6.453
	CRR073304	Juvenile bud 2	4.405
	CRR073305	Juvenile bud 3	7.395
	CRR073306	Third green 1	4.162
	CRR073307	Third green 2	2.451
	CRR073308	Third green 3	6.447
	CRR073309	Second white 1	1.409
	CRR073310	Second white 2	5.710
	CRR073311	Second white 3	6.124
	CRR073312	Silver flowering 1	4.487
	CRR073313	Silver flowering 2	0.989
	CRR073314	Silver flowering 3	3.425
	CRR073315	Gold flowering 1	9.863
	CRR073316	Gold flowering 2	13.300
	CRR073317	Gold flowering 3	4.873
	CRR073318	Tawny withering 1	3.101
	CRR073319	Tawny withering 2	2.779
	CRR073320	Tawny withering 3	1.014