Gene detail

Detail information of GWHGAAZE033642

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD30274.1	8.3811E-102	ribosomal protein L22 (chloroplast) [Lonicera japonica]
COG	YP_007108337.1	5E-35	50S ribosomal protein L22
Swissprot	tr\|Q332T7\|RK22_LACSA	3E-79	50S ribosomal protein L22, chloroplastic
trEMBL	tr\|D3WBS9\|D3WBS9_LONJA	3E-102	50S ribosomal protein L22, chloroplastic {ECO:0000256\|HAMAP-Rule:MF_01331, ECO:0000256\|RuleBase:RU004009}
TAIR10	ATCG00810.1	6E-49	ribosomal protein L22

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000106	gene	12441	12872	-
GWHAAZE00000106	mRNA	12441	12872	-
GWHAAZE00000106	exon	12441	12872	-
GWHAAZE00000106	CDS	12441	12872	-

Transcript Sequence
>GWHTAAZE033681 ATGTCTGCTCACAAAGCGCGAAGAGTAATTGATCAAATTCGTGGACGTTCCTACGAAGAAACACTTATGATACTAGAACTCATGCCTTATCGAGCATGTTATCCAATTTTTAAATTGGTTTATTCTGCAGCAGCAAATGCTAGTTACATTCTGGGTTCCAATGAAGCAAATTTAATCATTAGTAAAGCTGAAGTCAACGAGGGTACTGCCGTGAAGAAATTAAAACCTCGAGCTCGAGGACGTAGTTATCCGATAAAAAGACCTACCTGCCATATAACTATTATAGTGAAAGATATGTCCTTACCTGAATATGTAACGAAAAACTTTCTTGAATGGTCAAAAAAACCTAAATGGAAAAAATGGAAAAATAAGTATACAGATGTGACGTATCATGATATGTATAGTAATGGGGGAGTATGGGACAAAAAATAA

Network for GWHGAAZE033642

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0205

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00237.20	Ribosomal_L22	1	97	3.30E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02890	RP-L22, MRPL22, rplV	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0015934	cellular_component	large ribosomal subunit
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.099
	SRR3591706	second leaf	2.044
	SRR3591707	mature leaf	2.255
	SRR3591708	Shoot apex	7.119
	SRR3591709	Stem	1.430
	SRR3591710	White floral bud	0.832
	SRR3591711	White flower	1.487
	SRR3591712	Green floral bud	1.981
	SRR3591713	Yellow flower	1.261
SRP173429	SRR8316895	Juvenile bud stage	20.946
	SRR8316896	Juvenile bud stage	11.320
	SRR8316897	Juvenile bud stage	26.390
	SRR8316894	Third green stage	25.665
	SRR8316900	Third green stage	10.584
	SRR8316901	Third green stage	3.886
	SRR8316898	Complete white stage	6.714
	SRR8316899	Complete white stage	3.546
	SRR8316903	Complete white stage	5.744
	SRR8316902	Silver flowering stage	11.408
	SRR8316904	Silver flowering stage	11.640
	SRR8316905	Silver flowering stage	10.231
	SRR8316906	Gold flowering stage	3.841
	SRR8316907	Gold flowering stage	2.030
	SRR8316908	Gold flowering stage	3.264
SRP132670	SRR6706286	Control	0.778
	SRR6706287	Light intensity 50%	0.582
	SRR6706288	Light intensity 20%	0.582
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	60.699
	CNS0095593	Slightly white alabastrum(diploid) 2	37.499
	CNS0095594	Slightly white alabastrum(diploid) 3	64.116
	CNS0095595	Whole white alabastrum(diploid) 2	46.004
	CNS0095596	Whole white alabastrum(diploid) 3	32.169
	CNS0095597	Whole white alabastrum(diploid) 4	48.978
	CNS0095598	Silvery flower (diploied) 1	29.698
	CNS0095599	Silvery flower (diploied) 2	21.875
	CNS0095600	Silvery flower (diploied) 3	11.212
	CNS0095601	Golden flower (diploid) 1	32.493
	CNS0095602	Golden flower (diploid) 2	9.349
	CNS0095603	Golden flower (diploid) 3	9.657
	CNS0095604	Slightly white alabastrum(tetraploid) 1	25.776
	CNS0095605	Slightly white alabastrum(tetraploid) 2	33.048
	CNS0095606	Slightly white alabastrum(tetraploid) 3	11.347
	CNS0095607	Whole white alabastrum(tetraploid) 1	25.753
	CNS0095608	Whole white alabastrum(tetraploid) 2	34.002
	CNS0095609	Whole white alabastrum(tetraploid) 3	11.233
	CNS0095610	Silvery flower (tetraploid) 1	7.231
	CNS0095611	Silvery flower (tetraploid) 2	11.349
	CNS0095612	Silvery flower (tetraploid) 3	5.431
	CNS0095613	Golden flower (tetraploid) 1	11.291
	CNS0095614	Golden flower (tetraploid) 2	6.488
	CNS0095615	Golden flower (tetraploid) 3	10.082
CRA001975	CRR073297	Stem 1	13.963
	CRR073298	Stem 2	21.376
	CRR073299	Stem 3	7.493
	CRR073300	Leaf 1	13.311
	CRR073301	Leaf 2	12.004
	CRR073302	Leaf 3	7.219
	CRR073303	Juvenile bud 1	9.735
	CRR073304	Juvenile bud 2	5.559
	CRR073305	Juvenile bud 3	7.989
	CRR073306	Third green 1	4.403
	CRR073307	Third green 2	2.858
	CRR073308	Third green 3	7.658
	CRR073309	Second white 1	4.935
	CRR073310	Second white 2	16.152
	CRR073311	Second white 3	13.552
	CRR073312	Silver flowering 1	7.133
	CRR073313	Silver flowering 2	2.475
	CRR073314	Silver flowering 3	6.880
	CRR073315	Gold flowering 1	39.475
	CRR073316	Gold flowering 2	42.021
	CRR073317	Gold flowering 3	7.345
	CRR073318	Tawny withering 1	16.427
	CRR073319	Tawny withering 2	14.724
	CRR073320	Tawny withering 3	12.142