Gene detail

Detail information of GWHGAAZE033691

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006453353.1	1.05711E-73	hypothetical protein CICLE_v10009532mg [Citrus clementina]
COG	NP_682294.1	2E-36	ribulose bisphosphate carboxylase small subunit
Swissprot	tr\|P24007\|RBS_PYRPY	9E-62	Ribulose bisphosphate carboxylase small chain, chloroplastic (Precursor)
trEMBL	tr\|V4WIL3\|V4WIL3_9ROSI	4E-74	Ribulose bisphosphate carboxylase small chain {ECO:0000256\|RuleBase:RU003627}
TAIR10	AT1G67090.1	7E-46	ribulose bisphosphate carboxylase small chain 1A

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000115	gene	437878	439214	+
GWHAAZE00000115	mRNA	437878	439214	+
GWHAAZE00000115	exon	437878	438027	+
GWHAAZE00000115	exon	438987	439214	+
GWHAAZE00000115	CDS	437878	438027	+
GWHAAZE00000115	CDS	438987	439214	+

Transcript Sequence
>GWHTAAZE033731 ATGTTTGGGGGGCTAAAGACATGGGATCCAATGAATAACAAGAAGTTTGAGACACTGTCATACCTACCACCTCTGACAGATGAGTCAATTGCTAAGGAGATTGATTACATGATGAAGAAGGGTTGGATTCCTTGCCTTGAATTTGATGAGGTGGGGCATGTGTACAGGGAGAACAGCAGAATCCCAAATTACTATGATGGGAGGTACTGGACAATGTGGAAACTGCCCATGTTTGGATGCACTGATTCCTCTCAAGTACTTGAAGAAATCCAAGAGTGCAAAAAGGCATACCCAAACAGTTACATCCGGATCTTGGCTTTTGACAACATCAAACAGGGGCAATGCATGTCATTTCTCATTCAAAAACCCACCTCCTAA

Network for GWHGAAZE033691

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00101.21	RuBisCO_small	16	123	7.60E-43

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01602	rbcS	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Microbial metabolism in diverse environments	map01120
		Carbon metabolism	map01200
		Glyoxylate and dicarboxylate metabolism	map00630
		Carbon fixation in photosynthetic organisms	map00710

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	226.443
	SRR3591706	second leaf	2.451
	SRR3591707	mature leaf	0.178
	SRR3591708	Shoot apex	8.263
	SRR3591709	Stem	528.757
	SRR3591710	White floral bud	666.517
	SRR3591711	White flower	638.963
	SRR3591712	Green floral bud	147.701
	SRR3591713	Yellow flower	721.157
SRP173429	SRR8316895	Juvenile bud stage	5.184
	SRR8316896	Juvenile bud stage	9.702
	SRR8316897	Juvenile bud stage	6.144
	SRR8316894	Third green stage	6.250
	SRR8316900	Third green stage	71.701
	SRR8316901	Third green stage	60.190
	SRR8316898	Complete white stage	408.811
	SRR8316899	Complete white stage	285.766
	SRR8316903	Complete white stage	340.796
	SRR8316902	Silver flowering stage	274.023
	SRR8316904	Silver flowering stage	413.373
	SRR8316905	Silver flowering stage	325.850
	SRR8316906	Gold flowering stage	581.747
	SRR8316907	Gold flowering stage	731.385
	SRR8316908	Gold flowering stage	615.891
SRP132670	SRR6706286	Control	55.766
	SRR6706287	Light intensity 50%	83.971
	SRR6706288	Light intensity 20%	84.694
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	16.065
	CNS0095593	Slightly white alabastrum(diploid) 2	22.810
	CNS0095594	Slightly white alabastrum(diploid) 3	28.223
	CNS0095595	Whole white alabastrum(diploid) 2	53.947
	CNS0095596	Whole white alabastrum(diploid) 3	73.322
	CNS0095597	Whole white alabastrum(diploid) 4	156.169
	CNS0095598	Silvery flower (diploied) 1	275.881
	CNS0095599	Silvery flower (diploied) 2	312.650
	CNS0095600	Silvery flower (diploied) 3	598.670
	CNS0095601	Golden flower (diploid) 1	330.902
	CNS0095602	Golden flower (diploid) 2	394.454
	CNS0095603	Golden flower (diploid) 3	408.770
	CNS0095604	Slightly white alabastrum(tetraploid) 1	19.061
	CNS0095605	Slightly white alabastrum(tetraploid) 2	23.273
	CNS0095606	Slightly white alabastrum(tetraploid) 3	15.727
	CNS0095607	Whole white alabastrum(tetraploid) 1	56.748
	CNS0095608	Whole white alabastrum(tetraploid) 2	108.493
	CNS0095609	Whole white alabastrum(tetraploid) 3	71.351
	CNS0095610	Silvery flower (tetraploid) 1	517.370
	CNS0095611	Silvery flower (tetraploid) 2	713.127
	CNS0095612	Silvery flower (tetraploid) 3	607.625
	CNS0095613	Golden flower (tetraploid) 1	661.400
	CNS0095614	Golden flower (tetraploid) 2	520.715
	CNS0095615	Golden flower (tetraploid) 3	215.652
CRA001975	CRR073297	Stem 1	6.194
	CRR073298	Stem 2	5.251
	CRR073299	Stem 3	6.068
	CRR073300	Leaf 1	32.832
	CRR073301	Leaf 2	32.762
	CRR073302	Leaf 3	42.007
	CRR073303	Juvenile bud 1	291.165
	CRR073304	Juvenile bud 2	578.985
	CRR073305	Juvenile bud 3	237.071
	CRR073306	Third green 1	655.872
	CRR073307	Third green 2	794.303
	CRR073308	Third green 3	638.051
	CRR073309	Second white 1	1044.188
	CRR073310	Second white 2	359.018
	CRR073311	Second white 3	297.445
	CRR073312	Silver flowering 1	181.890
	CRR073313	Silver flowering 2	187.144
	CRR073314	Silver flowering 3	199.670
	CRR073315	Gold flowering 1	0.426
	CRR073316	Gold flowering 2	1.776
	CRR073317	Gold flowering 3	0.525
	CRR073318	Tawny withering 1	179.812
	CRR073319	Tawny withering 2	135.798
	CRR073320	Tawny withering 3	322.459